We narrowed to 4 results for: cre recombinase
-
TypeGuide...Plasmids: CRISPR transposases CRISPR Recombinases and Integrases Recombinases, and their subfamily integrases...for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert ...mechanisms, including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon...lab , pairs prime editing with a large serine recombinase (LSR). A prime editor is used to install the ...evoBxb1 or eeBxb1 are evolved versions of the recombinase with improved integration efficiencies in mammalian...& Hsu, P. D. (2022). Systematic discovery of recombinases for efficient integration of large DNA sequences... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...
-
Optogenetics Guide
TypeGuide...powerful when combined with site specific recombinase technology like Cre-lox, which allows you to express an...when one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half to CIB1...using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression of the opsin only.... Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression in... include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (... following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude Examples...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization... -
Sequencing Primers
TypeGuide...promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC... -
Adenovirus Guide
TypeGuide...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the... forward or reverse orientation, respectively. Created with BioRender.com. Adenoviruses are part of the...adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors in order ...deletions. Figure 2: First-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors...with first-generation rAdV vectors and further increase the transgene packaging capacity up to ~10.5 kb...vectors. Figure 3: Second-generation rAdV vectors. Created with BioRender.com. Third-generation rAdV vectors...