Skip to main content

We narrowed to 5 results for: cre recombinase

Showing: 1 - 5 of 5 results
  1. CRISPR Guide

    Type
    Guide
    ...Plasmids: CRISPR transposases CRISPR Recombinases and Integrases Recombinases, and their subfamily integrases...for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert ...mechanisms, including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon...lab , pairs prime editing with a large serine recombinase (LSR). A prime editor is used to install the ...evoBxb1 or eeBxb1 are evolved versions of the recombinase with improved integration efficiencies in mammalian...& Hsu, P. D. (2022). Systematic discovery of recombinases for efficient integration of large DNA sequences...GAT; increased nuclease fidelity SpCas9-NG — NG; increased in vitro activity SpG — NGN; increased nuclease...
  2. Optogenetics Guide

    Type
    Guide
    ...fragment of a protein of interest, such as Cre recombinase, is fused to Cry2 and the other fragment to...powerful when combined with site-specific recombinase systems like Cre-lox , which allows you to express an...using a viral vector with a floxed opsin in a VGAT-Cre animal will result in expression of the opsin only...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization...Anion-conducting ChR variants that inhibit neurons have been created and identified in other species. By acting as light-gated...amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step Function Opsins...noctigama ; ChrimsonR carries K176R mutation with increased on/off kinetics 590 ChRmine Red-shifted channelrhodopsin...
  3. Sequencing Primers

    Type
    Guide
    ...immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC...
  4. Adenovirus Guide

    Type
    Guide
    ...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the...Scientific Curation team at Addgene. Media Credits Figures created with BioRender (Link opens in a new window...Uses Safety Resources Plasmid Elements Glossary Credits Adenoviruses (AdV) are medium-sized, non-enveloped...adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors in order ...with first-generation rAdV vectors and further increase the transgene packaging capacity up to ~10.5 kb...Vogelstein’s lab , is the most popular method for creating first-generation rAdV vectors, which is still ...
  5. Molecular Biology Reference

    Type
    Guide
    ...our CRISPR Guide . CRISPR Plasmids , Cre-lox and Other Recombinases , TALEN Plasmids and Kits , Genome ... into a right-handed, double-stranded helix. To create the double helix, the nucleotides on the opposing...fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids Today... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...into target cells. You can use these plasmids to create viral particles (most commonly lentiviral, retroviral...method. Figure 3: Summary of Sanger sequencing. Created with BioRender.com. Next-generation Sequencing ...
Showing: 1 - 5 of 5 results