Skip to main content

We narrowed to 5 results for: cre recombinase

Showing: 1 - 5 of 5 results
  1. CRISPR Guide

    Type
    Guide
    ...Plasmids: CRISPR transposases CRISPR Recombinases and Integrases Recombinases, and their subfamily integrases...for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert ...mechanisms, including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon...lab , pairs prime editing with a large serine recombinase (LSR). A prime editor is used to install the ...evoBxb1 or eeBxb1 are evolved versions of the recombinase with improved integration efficiencies in mammalian...& Hsu, P. D. (2022). Systematic discovery of recombinases for efficient integration of large DNA sequences...GAT; increased nuclease fidelity SpCas9-NG — NG; increased in vitro activity SpG — NGN; increased nuclease...
  2. Optogenetics Guide

    Type
    Guide
    ...powerful when combined with site specific recombinase technology like Cre-lox, which allows you to express an...when one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half to CIB1...using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression of the opsin only... include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (... following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude Examples...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization...Alternatively, ChR variants that inhibit neurons have been created and identified in other species. By acting as light-gated...
  3. Sequencing Primers

    Type
    Guide
    ...immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC...
  4. Adenovirus Guide

    Type
    Guide
    ...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the... forward or reverse orientation, respectively. Created with BioRender.com. Adenoviruses are part of the...adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors in order ...deletions. Figure 2: First-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors...with first-generation rAdV vectors and further increase the transgene packaging capacity up to ~10.5 kb...vectors. Figure 3: Second-generation rAdV vectors. Created with BioRender.com. Third-generation rAdV vectors...
  5. Molecular Biology Reference

    Type
    Guide
    ...our CRISPR Guide . CRISPR Plasmids , Cre-lox and Other Recombinases , TALEN Plasmids and Kits , Genome ... into a right-handed, double-stranded helix. To create the double helix, the nucleotides on the opposing...fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids Today... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...into target cells. You can use these plasmids to create viral particles (most commonly lentiviral, retroviral...method. Figure 3: Summary of Sanger sequencing. Created with BioRender.com. Next-generation Sequencing ...
Showing: 1 - 5 of 5 results