Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 5 results for: gag pol

Showing: 1 - 5 of 5 results

  1. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...integration. Wildtype gamma-retroviruses contain the gag , pol , and env genes necessary for gamma-retroviral...gamma-retroviral vectors use the common packaging genes gag , pol , and env . The LTRs flank all of these required...Packaging plasmid — contains packaging genes gag and pol Envelope plasmid — contains packaging gene env...cell lines have been engineered to stably express gag-pol and/or env , eliminating the need to deliver these...Garry Nolan at Stanford. These cell lines contain gag-pol and either an ecotropic envelope, Phoenix-ECO (...days. Another variant, Phoenix-gp, contains only gag-pol and enables additional flexibility in pseudotyping...usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins at the beginning...

  2. Lentiviral Vector Guide

    Type
    Guide
    ...One plasmid encoding gag , pol , tat , and rev Two plasmids, one encoding gag/pol and another encoding...BioRender.com. All retroviruses use the packaging genes gag , pol , and env to create viral particles. Wild-type...Packaging plasmid — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated...and wild-type LTRs Packaging plasmid — contains gag , pol , tat , and rev Envelope plasmid — contains env...chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid...nuclear export. Provided by a separate plasmid from gag/pol in third-generation packaging plasmids. tat in ...promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins, by definition...

  3. Molecular Biology Reference

    Type
    Guide
    ...Glutamine Gln Q CAA, CAG Glutamic Acid Glu E GAA, GAG Glycine Gly G GGU, GGC, GGA, GGG Histidine His H ...DNA polymerase adding nucleotides. The major difference in this process occurs when the polymerase incorporates.... During replication, DNA unwinds and the DNA polymerase enzyme binds to and migrates down the single ...replication requires the 4 nucleotides, a DNA polymerase enzyme, the template DNA to be copied, and a ... DNA and acts as a starting point for the DNA polymerase. Thus to replicate a piece of DNA in vitro one...

  4. Sequencing Primers

    Type
    Guide
    ..., reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse primer CAT-R...vector, forward primer Polyhedrin forward AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer...primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For baculovirus vector with polyhedrin promoter...GAAATTTGTGATGCTATTGC SV40 polyA, reverse primer SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin, forward...TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 ...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end...AUG1 promoter, forward primer AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1...

  5. CRISPR Guide

    Type
    Guide
    ...SpCas9 VRER variant 3' NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, ...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...
Showing: 1 - 5 of 5 results