We narrowed to 5 results for: gag pol

...integration. Wildtype gamma-retroviruses contain the gag , pol , and env genes necessary for gamma-retroviral...gamma-retroviral vectors use the common packaging genes gag , pol , and env . The LTRs flank all of these required...Packaging plasmid — contains packaging genes gag and pol Envelope plasmid — contains packaging gene env...cell lines have been engineered to stably express gag-pol and/or env , eliminating the need to deliver these...Garry Nolan at Stanford. These cell lines contain gag-pol and either an ecotropic envelope, Phoenix-ECO (...days. Another variant, Phoenix-gp, contains only gag-pol and enables additional flexibility in pseudotyping...usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins at the beginning...

...One plasmid encoding gag , pol , tat , and rev Two plasmids, one encoding gag/pol and another encoding...BioRender.com. All retroviruses use the packaging genes gag , pol , and env to create viral particles. Wild-type...Packaging plasmid — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated...and wild-type LTRs Packaging plasmid — contains gag , pol , tat , and rev Envelope plasmid — contains env...chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid...nuclear export. Provided by a separate plasmid from gag/pol in third-generation packaging plasmids. tat in ...promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins, by definition...

...Glutamine Gln Q CAA, CAG Glutamic Acid Glu E GAA, GAG Glycine Gly G GGU, GGC, GGA, GGG Histidine His H ... DNA polymerase then binds to the single strand of DNA. Using this as a template, the polymerase migrates... requires the four nucleotides (dNTPs), a DNA polymerase enzyme, the template DNA to be copied, and a ... DNA and acts as a starting point for the DNA polymerase. Thus to replicate a piece of DNA in vitro, you...

...vector Forward Polyhedrin forward AAATGATAACCATCTCGC Polyhedrin promoter Forward Polyhedrin reverse GTCCAAGTTTCCCTG...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...beta-globin intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC...pHybLex Reverse GAGTCACTTTAAAATTTGTATACAC ADH terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage...-R GAAATTTGTGATGCTATTGC SV40 polyA Reverse SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin Forward...TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse...Forward V5 Reverse ACCGAGGAGAGGGTTAGGGAT V5 epitope Reverse WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE Reverse...

...SpCas9 VRER variant 3' NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, ...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...