...Plasmid All on one plasmid: Gag, Pol, Rev, Tat Two plasmids: one encoding Gag and Pol and another encoding Rev...destination vector (in this case the destination vector would be the lentiviral transfer vector). The destination...contains a single packaging plasmid encoding the Gag, Pol, Rev, and Tat genes. The transfer plasmid contains... plasmids: one encoding Rev and one encoding Gag and Pol. Although safer, this system can be more cumbersome... generation packaging systems: express the HIV gag, pol, rev, and tat genes all from a single packaging... . 3rd generation packaging systems: express gag and pol from one packaging plasmid and rev from another...lentiviruses and standard retroviruses use the gag, pol, and env genes for packaging; however, they are...

...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you are looking...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...specifically engineered plasmids, commonly referred to as vectors, which have become possibly the most ubiquitous...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...expression (for the purposes of gene study). Expression vectors must contain a promoter sequence, a transcription...the transcription process to stop. An expression vector can also include an enhancer sequence which increases... amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian...

...attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC MMLV... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ... in pMXs vector, forward primer Polyhedrin forward AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter... primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For baculovirus vector with polyhedrin promoter... For Pichia vectors with AUG1 promoter, forward primer AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen...

...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...based genome engineering from a single lentiviral vector. Nucleic Acids Research , 42 (19), e147. PMID: ...