Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 5 results for: gag pol vector

Showing: 1 - 5 of 5 results

  1. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Gamma-Retroviral Vector Guide Gamma-Retroviral Vector Guide Jump To: Gamma-Retroviral Vectors Vector Production....com. All gamma-retroviral vectors use the common packaging genes gag , pol , and env . The LTRs flank...viral vectors are produced in just a few days. Another variant, Phoenix-gp, contains only gag-pol and enables...gamma-retroviral vectors is essentially the same as lentiviral vectors. Many gamma-retroviral vectors have selectable...of Viruses Viral Vector Elements More Viral Vectors 101 topics More Retroviral Vector topics Addgene protocols...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...Gamma-retroviral vectors do not have defined “generations” of plasmids, as lentiviral vectors do. For more...

  2. Lentiviral Vector Guide

    Type
    Guide
    ...Lentiviral Vector Guide Lentiviral Vector Guide Jump To: Lentiviral Vectors Lentiviral Generations Vector Production...One plasmid encoding gag , pol , tat , and rev Two plasmids, one encoding gag/pol and another encoding...Viral Vectors 101 topics More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have ...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...gamma-retroviruses, see Addgene's gamma-retroviral vector guide . Lentiviral Vectors The genome of lentiviruses typically...BioRender.com. All retroviruses use the packaging genes gag , pol , and env to create viral particles. Wild-type...

  3. Molecular Biology Reference

    Type
    Guide
    ...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you are looking...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...specifically engineered plasmids, commonly referred to as vectors, which have become possibly the most ubiquitous...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...expression (for the purposes of gene study). Expression vectors must contain a promoter sequence, a transcription...the transcription process to stop. An expression vector can also include an enhancer sequence which increases... amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian...

  4. Sequencing Primers

    Type
    Guide
    ...attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC MMLV... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ... in pMXs vector, forward primer Polyhedrin forward AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter... primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For baculovirus vector with polyhedrin promoter... For Pichia vectors with AUG1 promoter, forward primer AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen...

  5. CRISPR Guide

    Type
    Guide
    ...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...based genome engineering from a single lentiviral vector. Nucleic Acids Research , 42 (19), e147. PMID: ...
Showing: 1 - 5 of 5 results