Skip to main content

We narrowed to 7 results for: gfp gene

Showing: 1 - 7 of 7 results
  1. Sequencing Primers

    Type
    Guide
    ...activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward...CCCAGTCACGACGTTGTAAAACG In lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV Forward...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Forward (-40) GTTTTCCCAGTCACGAC In lacZ gene Forward M13 Reverse ...CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG In lacZ gene Forward M13/pUC Reverse...neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F...puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP...
  2. Adenovirus Guide

    Type
    Guide
    ... contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest. With...provide a large transgene packaging capacity. Large protein-coding genes and complex gene expression cassettes...(2017). Adenovirus-mediated gene delivery: potential applications for gene and cell-based therapies in..., subsequent generations of rAdV vectors have been developed where more adenoviral genes have been removed...deletions of first-generation rAdV vectors, as well as the deletion of the other early gene regions, E2 and...containing the adenoviral genes necessary for viral production. In AdEasy™, the transgene of interest is cloned...containing the transgene of interest, and the adenoviral plasmid containing the adenoviral genes necessary ...
  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...the necessary packaging genes, while lentiviruses also contain accessory genes specific to each virus ...common packaging genes gag , pol , and env . The LTRs flank all of these required genes, and anything in...— contains packaging genes gag and pol Envelope plasmid — contains packaging gene env ; usually VSV-G ... envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope gene, as it has...commonly used in gene therapy applications to more specifically direct delivery of gene therapies. Common...gamma-retroviral vectors. Gene Therapy Gamma-retroviral vectors are a popular choice in gene therapy applications...production, in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans ...
  4. Lentiviral Vector Guide

    Type
    Guide
    ...strand of RNA contains packaging genes, regulatory genes, accessory genes, and the long-terminal repeats...shRNA , and overexpressing of oncogenes and other disease-associated genes. Gene Therapy Due to their relative...complex genomes, containing packaging genes and accessory genes specific to each virus type, while retroviruses...require the regulatory genes tat and rev , along with virus-specific accessory genes (for example, vif , ...Packaging plasmid — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated into two... envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope gene, as it has...two plasmids in third generation systems Envelope plasmid — contains packaging gene env (usually VSV-G due...
  5. Modular Cloning Guide

    Type
    Guide
    ...building synthetic genetic circuits, engineering metabolic pathways, assembling gene-editing tools, and...-YTK (Dueber) for genetic engineering of S. cerevisiae , enabling larger multi-gene constructs, multiplexed...Pluskal Plasmid kit for assembly of single-gene and multigene plasmids for genome integration in fission...Bacterial Expression Thomas Lahaye Plasmids to generate gene knockout and complementation constructs for ...promoter, a 5' UTR, a signal peptide, a protein-coding gene, and a terminator, as in Figure 1). Next, up to ...Cloning System (Lohmann) to create plasmids with multi-gene constructs for plant transformation. GoldenBraid...plant transformation vectors for overexpression, gene editing, functional genomics, and more complex metabolic...
  6. Molecular Biology Reference

    Type
    Guide
    ...function of genetic elements. These plasmids contain a reporter gene (e.g., luciferase or GFP) that offers...promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA fragment cloned ...Expression Plasmids Used for gene expression, usually for the purposes of gene study. Expression vectors ... Backbones Gene Knock-down Plasmids Used for reducing the expression of an endogenous gene. This is frequently...Sequencing Primers Origins of Molecular Genetics The concept of genes as carriers of phenotypic information...scientists can easily study and manipulate genes and other genetic elements using specifically engineered ...chromosomes down to study their genes, marking the birth of molecular genetics. To learn more about different...
  7. CRISPR Guide

    Type
    Guide
    ... editing multiple genes at once; using dual nickases to generate a knockout or gene edit; or using Cas9...the targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the...eliminate target gene function. It has also been used extensively to screen for novel genes that regulate... activate, or repress genes. Each library typically contains ∼3–6 gRNAs per gene to ensure modification...repress, visualize, and isolate genes. Activation or Repression of Target Genes Targeting dCas9 to transcription...single-gene activation (Figure 9D) Figure 9: Overview of CRISPRi/a. In bacteria, activating gene expression... of effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have...
Showing: 1 - 7 of 7 results