Skip to main content
Addgene

We narrowed to 8 results for: gfp gene

Showing: 1 - 8 of 8 results
  1. Sequencing Primers

    Type
    Guide
    ...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...In lacZ gene M13 (-40) GTTTTCCCAGTCACGAC In lacZ gene M13 Reverse CAGGAAACAGCTATGAC In lacZ gene M13/pUC...Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG...resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, reverse ...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine...ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...
  2. Adenovirus Guide

    Type
    Guide
    ... contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest. With...provide a large transgene packaging capacity. Large protein-coding genes and complex gene expression cassettes...(2017). Adenovirus-mediated gene delivery: potential applications for gene and cell-based therapies in..., subsequent generations of rAdV vectors have been developed where more adenoviral genes have been removed...containing the adenoviral genes necessary for viral production. In AdEasy™, the transgene of interest is cloned...containing the transgene of interest, and the adenoviral plasmid containing the adenoviral genes necessary ...second and third-generation vectors. This capacity is large enough to carry the Cas9 gene and a gRNA expression...
  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...the necessary packaging genes, while lentiviruses also contain accessory genes specific to each virus ...common packaging genes gag , pol , and env . The LTRs flank all of these required genes, and anything in...— contains packaging genes gag and pol Envelope plasmid — contains packaging gene env ; usually VSV-G ... envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope gene, as it has...commonly used in gene therapy applications to more specifically direct delivery of gene therapies. Common...gamma-retroviral vectors. Gene Therapy Gamma-retroviral vectors are a popular choice in gene therapy applications...production, in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans ...
  4. Lentiviral Vector Guide

    Type
    Guide
    ...strand of RNA contains packaging genes, regulatory genes, accessory genes, and the long-terminal repeats...shRNA , and overexpressing of oncogenes and other disease-associated genes. Gene Therapy Due to their relative...complex genomes, containing packaging genes and accessory genes specific to each virus type, while retroviruses...require the regulatory genes tat and rev , along with virus-specific accessory genes (for example, vif , ...Packaging plasmid — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated into two... envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope gene, as it has...two plasmids in third generation systems Envelope plasmid — contains packaging gene env (usually VSV-G due...
  5. Modular Cloning Guide

    Type
    Guide
    ...building synthetic genetic circuits, engineering metabolic pathways, assembling gene-editing tools, and...-YTK (Dueber) for genetic engineering of S. cerevisiae , enabling larger multi-gene constructs, multiplexed...Pluskal Plasmid kit for assembly of single-gene and multigene plasmids for genome integration in fission...Bacterial Expression Thomas Lahaye Plasmids to generate gene knockout and complementation constructs for ...promoter, a 5' UTR, a signal peptide, a protein-coding gene, and a terminator, as in Figure 1). Next, up to ...Cloning System (Lohmann) to create plasmids with multi-gene constructs for plant transformation. GoldenBraid...plant transformation vectors for overexpression, gene editing, functional genomics, and more complex metabolic...
  6. Optogenetics Guide

    Type
    Guide
    ...plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ, ePDZb and ePDZb1 as tags. pDawn/pDusk...pDusk Blue-light photoreceptor for light-controlled gene expression. These plasmids rely on the engineered... Science Guides Optogenetics Guide Optogenetics Guide Jump To: Optogenetics Guide Introduction Microbial...Collection . To find optogenetics plasmids available through Addgene, check out our Optogenetics Plasmid Collection...Addgene's guide to using Optogenetics plasmids in your lab, including explanations of microbial opsin...References Introduction The field of optogenetics integrates optics and genetic engineering to measure and manipulate...from Kir2.1 540 Plan Your Optogenetics Experiment When designing your optogenetics experiment, you’ll need...
  7. Molecular Biology Reference

    Type
    Guide
    ...reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic element...bacterial populations, an antibiotic resistance gene (i.e., a gene whose product confers resistance to ampicillin...transcription. Gene Knock-down Plasmids - Used for reducing the expression of an endogenous gene. This is frequently...chromosomes down to study their genes, marking the birth of molecular genetics. Today, scientists can easily...easily study and manipulate genes and other genetic elements using specifically engineered plasmids, commonly...when a gene is inserted within the MCS, its expression will be driven by the promoter. As a general rule...the gene, promoter, or other DNA fragment cloned into the MCS. The insert is typically the genetic element...
  8. CRISPR Guide

    Type
    Guide
    ... editing multiple genes at once; using dual nickases to generate a knockout or gene edit; or using Cas9...the targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the...eliminate target gene function. It has also been used extensively to screen for novel genes that regulate... activate, or repress genes. Each library typically contains ∼3–6 gRNAs per gene to ensure modification...repress, visualize, and isolate genes. Activation or Repression of Target Genes Figure 9: Overview of CRISPRi...highest levels of single-gene activation (Figure 9D) In bacteria, activating gene expression is more difficult... of effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have...
Showing: 1 - 8 of 8 results