...ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX...Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP...cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette, forward primer...of Gateway cassette, reverse primer H1 TCGCTATGTGTTCTGGGAAA Human H1 promoter, forward primer HA-F TACCCATACGACGTCCCAGA...Waugh lab) 3' end of maltose binding protein, forward primer mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry...in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors...Invitrogen) 3' of MCS in pTrcHis vector, same as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end ...

... U3; Unique 3'; region at the 3' end of viral genomic RNA (but found at both the 5' and 3' ends of the...virus production are split across multiple plasmids (3 for 2nd-generation systems, 4 for 3rd-generation systems...incompetent and may contain an additional deletion in the 3'LTR, rendering the virus “self-inactivating” (SIN)... VSV-G Safety Safe. Replication incompetent: Uses 3 separate plasmids encoding various HIV genes. Safer...incompetent and always SIN: Uses 4 plasmids instead of 3 and eliminates the requirement for Tat. LTR Viral ...is outlined in the simple schematic to the right. 3-4 plasmids are transfected into A293T cells: one transfer... lentiviral plasmids, such as pLKO.1, use a U6 or H1 promoter in order to drive RNA pol III-directed transcription...