...12247 pLVTHM Expresses shRNA under the H1 promoter; shRNA or a H1-shRNA cassette from another vector (e.g...generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick Aebischer...generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick ...generation; Transgene (hEF-1alpha promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick Aebischer...generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick Aebischer...generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick ...generation; Transgene (hUbiquitin promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick Aebischer...

...nicks the non-target strand and generates a 3’ flap. The 3’ flap binds to the primer binding site (PBS...Drosophila U6:3 pegRNA BbsI No Vermilion Norbert Perrimon pCFD5-NS Drosophila Drosophila U6:3 pegRNA + nicking...No mRFP1 David Liu U6-pegRNA-H1-nick sgRNA-mCherry Mammalian, AAV hU6 + H1 pegRNA + nicking sgRNA No mCherry...mismatch repair (MMR) system. Alternatively, the edited 3’ flap may be excised and the target sequence will ...

...ssRNA engaging one strand of a dsDNA molecule; the 3-stranded structure produced is known as an R-loop....The two dominating RNases in mammalian cells (RNase H1 and H2) handle most of these intermediates, with ...

...Strong yeast expression promoter from glyceraldehyde 3-phosphage dehydrogenase Constitutive  Very strong,... Constitutive  Gives high expression in plants. H1 small RNA expression shRNA From the human polymerase...

... express shRNA (cloning H1-shRNA cassettes into the unique SnaBI site in the 3´-LTR). See here for other...GFP and shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible...

... Zack pHL-H1-ccdB-mEF1a-RiH 60601 Mammalian BamHI/EcoRI none S. pyogenes Hygro Hotta pUC-H1-gRNA 61089...Bacteria SpeI + HindIII none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. ...pyogenes Musunuru pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI) 64217 Mammalian BbsI yes, cut S. pyogenes...LEU2 Wheeldon FgH1tUTG 70183 Mammalian/Lentiviral H1-Tet none S. pyogenes Herold lentiGuide-Crimson 70683... Puro Abbosh pCFD3-MS2tail-Scaffold 78906 Fly dU6:3 none S. pyogenes Virmilion Perrimon pHDE-35S-Cas9-...polycistronic lentiviruses. Can express Cas9 with up to 3 gRNAs. Frew pSQT1313 Mammalian Single plasmid for ...expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes endogenous...

...downstream of the 7SK, human U6, mouse U6, or human H1 promoters. If you express fewer than four gRNAs, ...to supply it with another plasmid.   Figure 3: Comparison of Multiplex Strategies including Standard...For example, if you were to develop an array using 3 distinct spacer-repeats, you could easily create 7...a subsequent curing protocol that requires only 2-3 hours incubation. Kondo Lab multiplexed base editing...PMC4231726. Find plasmids from this paper at Addgene. 3. Sakuma, Tetsushi, et al. “Multiplex genome engineering...

...ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX...Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP...cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette, forward primer...of Gateway cassette, reverse primer H1 TCGCTATGTGTTCTGGGAAA Human H1 promoter, forward primer HA-F TACCCATACGACGTCCCAGA...Waugh lab) 3' end of maltose binding protein, forward primer mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry...in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors...Invitrogen) 3' of MCS in pTrcHis vector, same as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end ...

...EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1mismatch... 14542 pLV.ATMi ATM H1 Ataxia telangiectasia Didier Trono 14581 pSUPER.ATMi ATM H1 Ataxia telangiectasia...shSOD1mismatch SOD1 H1 ALS Patrick Aebischer 11442 pBabe bleo human Frataxin FXN Friedreich ataxia Ronald Kahn 11443...TLS 2: hTLS.pCDNA1 FUS CMV ALS David Ron 21829 TLS 3: TLS.pRSET.C FUS His T7 ALS David Ron 21830 TLS 4:...Parkinson's Cheryl Arrowsmith 26210 pSUPER TBK1 TBK1 H1 ALS Tom Maniatis 26365 pENTR4_FLAG/HA_FUS_His6 FUS...David Root 78523 pFUChW Parkin shRNA Mul1 shRNA PRKN H1 Parkinson's David Chan 78622 pX335_HR_Prnp_3 PRNP... APEX2 CMV Parkinson's Mark Cookson 165107 pGEX4T-3-6AOptParkin PRKN GST tac Parkinson's Arthur Haas 166671...

...at the 5′ or 3′ end of the sgRNA (i.e. TOP1 or TOP2 constructs; see Supplementary Note 3 in the article...Polstein LR & Gersbach CA, Nat Chem Biol 2015 Mar;11(3):198-200. SunTag system for single molecule imaging...protein (NLS-PCP-GFP) a RFP protein that binds to the 3’ UTR of the reporter mRNA via an MS2 coat protein ... (U6) expression, shRNA/shRNA-miR30 constitutive (H1, U6, 7SK) or inducible shRNA-miR30 (CMV-TO) expression..., (2) tamoxifen-inducible CreERT2 gene deletion, (3) simultaneous expression of cDNAs and shRNAs with ...8 constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces for inducible... 2012, Adam Cohen's lab presented Archaerhodopsin 3 (Arch) as a new rhodopsin based voltage indicator ...

... U3; Unique 3'; region at the 3' end of viral genomic RNA (but found at both the 5' and 3' ends of the...virus production are split across multiple plasmids (3 for 2nd-generation systems, 4 for 3rd-generation systems...incompetent and may contain an additional deletion in the 3'LTR, rendering the virus “self-inactivating” (SIN)... VSV-G Safety Safe. Replication incompetent: Uses 3 separate plasmids encoding various HIV genes. Safer...incompetent and always SIN: Uses 4 plasmids instead of 3 and eliminates the requirement for Tat. LTR Viral ...is outlined in the simple schematic to the right. 3-4 plasmids are transfected into A293T cells: one transfer... lentiviral plasmids, such as pLKO.1, use a U6 or H1 promoter in order to drive RNA pol III-directed transcription...

...immunoglobulin heavy diversity 3-22 IGHD322 IGHD3-3 immunoglobulin heavy diversity 3-3 DXP4, IGHD33 IGHD3-9 immunoglobulin...VH IGHV3-30-3 immunoglobulin heavy variable 3-30-3 IGHV3-3, IGHV3303 IGHV3-30-5 immunoglobulin heavy variable...motif) ligand 3-like 2 G0S19-3, LD78gamma, SCYA3L2 CCL3L3 chemokine (C-C motif) ligand 3-like 3 464.2, D17S1718... variable 3-30-5 IGHV3-3, IGHV3305 IGHV3-33 immunoglobulin heavy variable 3-33 IGHV333, VH IGHV3-35 immunoglobulin...lambda variable 3-9 (gene/pseudogene) IGLV39, V2-6 IGLV4-3 immunoglobulin lambda variable 4-3 IGLV43, V5-1..., MRS DEFA3 defensin, alpha 3, neutrophil-specific DEF3, HNP-3, HNP3, HP-3 DEFA5 defensin, alpha 5, Paneth...