We narrowed to 10 results for: h1-3

...nicks the non-target strand and generates a 3’ flap. The 3’ flap binds to the PBS of the pegRNA and the...Drosophila U6:3 pegRNA BbsI No Vermilion Norbert Perrimon 149546 pCFD5-NS Drosophila Drosophila U6:3 pegRNA ...176901 U6-pe RNA-H1-nick sgRNA-mCherry Mammalian, AAV hU6 + H1 pegRNA + nicking sgRNA No mCherry...repair (MMR) system. Alternatively, if the edited 3’ flap is excised, the target sequence remains unchanged...stability epegRNA — additional protection added to 3’ tail of pegRNA to prevent RNA degradation For more...

... combining tet O sequences with elements like the H1 RNA promoter. And, most importantly, the TetR protein.... See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri Wiederschain 85966 EZ-Tet-pLKO-Puro Lentiviral...and Plasmid #85972 for hygromycin selection. TetR H1-2O2 Cindy Miranti 104321 tet-pLKO-sgRNA-puro Lentiviral...Tet-On plasmid for inducible expression of sgRNA TetR H1-2O2 Nathanael Gray 35625 pAAV-Ptet-RFP-shR-rtTA AAV...plasmids for shRNA or gene expression. rtTA-Advanced H1-2O2 Stephen Elledge 111177 LT3GEPIR Lentiviral Tet-On...Doxycycline-inducible Gene Expression . Curr Gene Ther, 16 (3), 156–167. https://doi.org/10.2174/1566523216666160524144041...and E with an inducible system . Mol Cell Biol, 14 (3), 1669–1679. https://doi.org/10.1128/mcb.14.3.1669...

...ssRNA engaging one strand of a dsDNA molecule; the 3-stranded structure produced is known as an R-loop....The two dominating RNases in mammalian cells (RNase H1 and H2) handle most of these intermediates, with ...

... express shRNA (cloning H1-shRNA cassettes into the unique SnaBI site in the 3´-LTR). Find more pULTRA...GFP and shRNA under the control of a tet-responsive H1 promoter. Didier Trono 11651 pLVUT-tTR-KRAB 3rd Inducible...

...Strong yeast expression promoter from glyceraldehyde 3-phosphage dehydrogenase Constitutive  Very strong,... Constitutive  Gives high expression in plants. H1 small RNA expression shRNA From the human polymerase...

...downstream of the 7SK, human U6, mouse U6, or human H1 promoters. If you express fewer than four gRNAs, ...to supply it with another plasmid.   Figure 3: Comparison of Multiplex Strategies including Standard...For example, if you were to develop an array using 3 distinct spacer-repeats, you could easily create 7...a subsequent curing protocol that requires only 2-3 hours incubation. Kondo Lab multiplexed base editing...PMC4231726. Find plasmids from this paper at Addgene. 3. Sakuma, Tetsushi, et al. “Multiplex genome engineering...

...ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector/td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX... For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors Reverse ...Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain Forward Gal4-AD AATACCACTACAATGGAT 3' end of Gal4 activation...S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette Forward GW-5'...5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA Human H1 promoter Forward HA-F TACCCATACGACGTCCCAGA...GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry...

...EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1mismatch... 14542 pLV.ATMi ATM H1 Ataxia telangiectasia Didier Trono 14581 pSUPER.ATMi ATM H1 Ataxia telangiectasia...shSOD1mismatch SOD1 H1 ALS Patrick Aebischer 11443 pBS human Frataxin (myc tag) FXN Myc T7 Friedreich ataxia Ronald...TLS 2: hTLS.pCDNA1 FUS CMV ALS David Ron 21829 TLS 3: TLS.pRSET.C FUS His T7 ALS David Ron 21830 TLS 4:...Parkinson's Cheryl Arrowsmith 26210 pSUPER TBK1 TBK1 H1 ALS Tom Maniatis 26365 pENTR4_FLAG/HA_FUS_His6 FUS...David Root 78523 pFUChW Parkin shRNA Mul1 shRNA PRKN H1 Parkinson's David Chan 78622 pX335_HR_Prnp_3 PRNP... APEX2 CMV Parkinson's Mark Cookson 165107 pGEX4T-3-6AOptParkin PRKN GST tac Parkinson's Arthur Haas 166671...

...at the 5′ or 3′ end of the sgRNA (i.e. TOP1 or TOP2 constructs; see Supplementary Note 3 in the article...Polstein LR & Gersbach CA, Nat Chem Biol 2015 Mar;11(3):198-200. SunTag system for single molecule imaging...protein (NLS-PCP-GFP) a RFP protein that binds to the 3’ UTR of the reporter mRNA via an MS2 coat protein ... (U6) expression, shRNA/shRNA-miR30 constitutive (H1, U6, 7SK) or inducible shRNA-miR30 (CMV-TO) expression..., (2) tamoxifen-inducible CreERT2 gene deletion, (3) simultaneous expression of cDNAs and shRNAs with ...8 constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces for inducible... 2012, Adam Cohen's lab presented Archaerhodopsin 3 (Arch) as a new rhodopsin based voltage indicator ...

...immunoglobulin heavy diversity 3-22 IGHD322 IGHD3-3 immunoglobulin heavy diversity 3-3 DXP4, IGHD33 IGHD3-9 immunoglobulin...VH IGHV3-30-3 immunoglobulin heavy variable 3-30-3 IGHV3-3, IGHV3303 IGHV3-30-5 immunoglobulin heavy variable...motif) ligand 3-like 2 G0S19-3, LD78gamma, SCYA3L2 CCL3L3 chemokine (C-C motif) ligand 3-like 3 464.2, D17S1718... variable 3-30-5 IGHV3-3, IGHV3305 IGHV3-33 immunoglobulin heavy variable 3-33 IGHV333, VH IGHV3-35 immunoglobulin...lambda variable 3-9 (gene/pseudogene) IGLV39, V2-6 IGLV4-3 immunoglobulin lambda variable 4-3 IGLV43, V5-1..., MRS DEFA3 defensin, alpha 3, neutrophil-specific DEF3, HNP-3, HNP3, HP-3 DEFA5 defensin, alpha 5, Paneth...