Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 4 results for: human c myc

Showing: 1 - 4 of 4 results

  1. Sequencing Primers

    Type
    Guide
    ...CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla...Weinberg Lab) Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter... promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F ...TCAAGCCTCAGACAGTGGTTC (Invitrogen) Human elongation factor-1a promoter, forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG...forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT... CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer LKO...LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LucNrev CCTTATGCAGTTGCTCTCC...

  2. Molecular Biology Reference

    Type
    Guide
    ... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...thousand basepairs from the entire human genome. Digesting the human genome with restriction enzymes would...plasmid in intended for use in human cells, the promoter will be a human or mammalian promoter sequence...Thymine (T), Cytosine (C) and Guanine (G). In the double helix A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...molecules. In order to isolate a particular gene from human chromosomal DNA, it would be necessary to isolate...including plants, worms, mice, and even cultured human cells. Although plasmids were originally used to...

  3. Lentiviral Vector Guide

    Type
    Guide
    ...Ehrnstroem, B., & Baum, C. (2013). Biosafety features of lentiviral vectors. Human Gene Therapy , 24 (2).... M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...species. Some common types of lentivirus include Human immunodeficiency virus (HIV), bovine immunodeficiency...process requires a production cell line, typically human embryonic kidney 293T (HEK293T) cells. Standard ... Genome-Scale CRISPR-CAS9 knockout screening in human cells. Science , 343 (6166), 84–87. https://doi....PMID: 33768124 Marshall, H. M., Ronen, K., Berry, C., Llano, M., Sutherland, H., Saenz, D., Bickmore, ...PMID: 18092005 Merten, O., Hebben, M., & Bovolenta, C. (2016). Production of lentiviral vectors. Molecular...

  4. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...-retroviral vectors can be packaged directly in human embryonic kidney 293T (HEK293T) cells (Figure 3A.... M. (2003). Transcription start regions in the human genome are favored targets for MLV integration. ...Wong, G. K., Cameron, E. R., Kilbey, A., & Neil, J. C. (2016). Gamma-Retrovirus integration marks cell Type-Specific...10.1371/journal.pone.0154070 PMID: 27097319 LaFave, M. C., Varshney, G. K., Gildea, D. E., Wolfsberg, T. G....gkt1399 PMID: 24464997 Maetzig, T., Galla, M., Baum, C., & Schambach, A. (2011). Gammaretroviral vectors:...Rubat, L., Nikoniuk, A., Macmorland, W., Horlock, C., Matsumoto, S., Williams, S., Smith, K., Price, J... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...
Showing: 1 - 4 of 4 results