Skip to main content

We narrowed to 4 results for: human c myc

Showing: 1 - 4 of 4 results
  1. Sequencing Primers

    Type
    Guide
    ...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward...GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward...Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' ...Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3'...Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F TGGCTCTCCTCAAGCGTATT...
  2. Molecular Biology Reference

    Type
    Guide
    ... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...thousand base pairs from the entire human genome. Digesting the human genome with restriction enzymes would...Thymine (T), Cytosine (C) and Guanine (G). In the double helix, A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...DNA molecules. To isolate a particular gene from human chromosomal DNA, it would be necessary to isolate...organisms, including plants, worms, mice, and cultured human cells. Have diverse applications — Although plasmids...strains of E. coli , some of which are deadly to humans. Most of all common, commercial lab strains of ...
  3. Lentiviral Vector Guide

    Type
    Guide
    ...Ehrnstroem, B., & Baum, C. (2013). Biosafety features of lentiviral vectors. Human Gene Therapy , 24 (2).... M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...species. Some common types of lentivirus include Human immunodeficiency virus (HIV), bovine immunodeficiency...process requires a production cell line, typically human embryonic kidney 293T (HEK293T) cells. Standard ... Genome-Scale CRISPR-CAS9 knockout screening in human cells. Science , 343 (6166), 84–87. https://doi....PMID: 33768124 Marshall, H. M., Ronen, K., Berry, C., Llano, M., Sutherland, H., Saenz, D., Bickmore, ...PMID: 18092005 Merten, O., Hebben, M., & Bovolenta, C. (2016). Production of lentiviral vectors. Molecular...
  4. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...-retroviral vectors can be packaged directly in human embryonic kidney 293T (HEK293T) cells (Figure 3A.... M. (2003). Transcription start regions in the human genome are favored targets for MLV integration. ...Wong, G. K., Cameron, E. R., Kilbey, A., & Neil, J. C. (2016). Gamma-Retrovirus integration marks cell Type-Specific...10.1371/journal.pone.0154070 PMID: 27097319 LaFave, M. C., Varshney, G. K., Gildea, D. E., Wolfsberg, T. G....gkt1399 PMID: 24464997 Maetzig, T., Galla, M., Baum, C., & Schambach, A. (2011). Gammaretroviral vectors:...Rubat, L., Nikoniuk, A., Macmorland, W., Horlock, C., Matsumoto, S., Williams, S., Smith, K., Price, J... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...
Showing: 1 - 4 of 4 results