...promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT... TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer HAT GAGGAGCACGCTCATGCCCAC...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end...

... Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST...nucleotides. Epitope tags on the other hand are commonly used in molecular cloning to tag a gene within a ...random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in addition to...T, C, or G nucleotide. The 4 standard bases are tagged with a different fluorophore so they can be distinguished...when the polymerase incorporates a fluorescently tagged nucleotide. Because these special bases do not ..., the reaction is halted once the fluorescently tagged base is incorporated. Sanger sequencing requires...because the ultimate goal is to have a fluorescently tagged nucleotide at each position in the DNA sequence...

... genomes have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...the transfer vector during the viral production stage. Many of the lentiviral transfer vectors that have...Flap. Zennou V, Petit C, Guetard D, Nerhbass U, Montagnier L, Charneau P. Cell. 2000. 101(2): 173-185. PubMed...