We narrowed to 4 results for: myc tag

...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance...HA-F TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC...GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F GCGTTCAAAAGTCGCCTAAG...

... Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST...sequence. Epitope tags, on the other hand, are commonly used in molecular cloning to tag a gene within a...random incorporation of modified, fluorescently-tagged bases during in vitro DNA replication in addition...nucleotides. The four standard bases (dNTPs) are tagged with a different fluorophore so they can be distinguished...distinguished from one another. These tagged dNTPs also lack a binding site for the next nucleotide (denoted...because the ultimate goal is to have a fluorescently-tagged nucleotide at each position in the DNA sequence...Like Sanger, NGS utilizes modified, fluorescently-tagged nucleotides. During Illumina NGS, a long piece ...

...screens, in vivo mutagenesis, pathway mapping, and drug resistance studies. Advantages Broad range of perturbation...transcription factors), or observing the effects of mutagenesis of a single gene. As you might have guessed from...monitor the dynamics of heterogeneous tumors. Advantages Extremely high resolution clonal tracking Low...purposes, such as barcoding or targeting RNA. Advantages Strong, specific loss of function (knockout) ...protein engineering, and ligand discovery. The key advantage of this approach is the ability to screen large...system, proteins are displayed on the surface of Saccharomyces cerevisiae , often by fusion to the Aga2p protein...complex eukaryotic proteins, such as antibodies. Advantages Explore vast sequence diversity Can map epitopes...

... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...information (including tropism and viral genome percentage) and resources on viral safety. Resources and...