Skip to main content
Addgene
Showing: 1 - 3 of 3 results

  1. Sequencing Primers

    Type
    Guide
    ...primer pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT...origin, forward primer GAL1 AATATACCTCTATACTTTAACGTC (Invitrogen) S. cerevisiae GAL1 promoter, forward primer...primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4...GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain, forward primer Gal4-AD AATACCACTACAATGGAT (BD Biosciences...useful in your sequencing reaction, find your plasmid page and see what primers are listed under "5' sequencing...please consult Addgene's Molecular Biology Reference Page . All listed primers are 5′ to 3′. Commonly Used...Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP...

  2. Molecular Biology Reference

    Type
    Guide
    ...drive expression in various cell types (mammalian, yeast, bacterial, etc.), depending largely on which promoter...England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC...viral service page to learn more. Regardless of type, plasmids are generally propagated, selected for,...Delta-lacX74 recA1 araDelta139 D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen...(TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15 e14- Φ80dlacZ∆M15 recA1 relA1 endA1 nupG rpsL...Delta-lacX74 recA1 araD139 Delta(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG Antibiotics commonly used...Introduction Types of Plasmids E. coli strains for propagating plasmids Antibiotics commonly used for plasmid...

  3. CRISPR Guide

    Type
    Guide
    ...libraries are also available, such as those for yeast or drosophila . Although CRISPR has been less widely...SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology , 36 (3), 265–271. PMID: 29431739...plasmids and resources at Addgene Blog CRISPR topic page How to design your gRNA for CRISPR genome editing... Gainetdinov, I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer... Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., Han, Y., Ogrodowski, P., Crippa, A., Rekhtman...
Showing: 1 - 3 of 3 results