We narrowed to 2 results for: pgk promoter

1. Promoters

   Type

   Guide

   ...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream...Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian promoter from phospholycerate kinase ...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac...

2. Sequencing Primers

   Type

   Guide

   ...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer...LTR (MoMuLV), forward primer mPGK-F CATTCTGCACGCTTCAAAAG Mouse PGK promoter, forward primer MSCV CCCTTGAACCTCCTCGTTCGACC... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...