...Browse Plasmids: Purify Cas9 Alternatives for CRISPR Genome Engineering S. pyogenes Cas9 (SpCas9) is the...Addgene's guide to using CRISPR plasmids in your lab, from knockouts to pooled library screening. Science... cell must be validated experimentally. Browse Plasmids: Double-Strand Break (Cut) Multiplex Genome Engineering...cases, delivering multiple gRNAs using a single plasmid ensures that all gRNAs will be expressed in the...likelihood that any cell containing the CRISPR plasmid will have all desired genomic edits carried out...genetic loci by cloning multiple gRNAs into a single plasmid — though some have achieved targeting in the double...later. Read more about Cas9 multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease...

... For sequencing plasmids in our repository, we've chosen primers based on the plasmid backbone and insert...reverse primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer...uses for sequence verification of deposited plasmids. Plasmid... Plasmid Reference Molecular Biology Reference Sequencing... useful in your sequencing reaction, find your plasmid page and see what primers are listed under "5' ... for sanger sequence verification of deposited plasmids. Below is a list of commonly used primers. This...primer pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of Drosophila mini-white gene, reverse primer ...