We narrowed to 3 results for: puromycin selection marker

1. Sequencing Primers

   Type

   Guide

   ...forward primer pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1...primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...

2. Gamma-Retroviral Vector Guide

   Type

   Guide

   ...type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...gamma-retroviral vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic...Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells ...& Burgess, S. M. (2014). MLV integration site selection is driven by strong enhancers and active promoters...

3. Lentiviral Vector Guide

   Type

   Guide

   ...type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead... Many lentiviral vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic...Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells ...