Skip to main content

We narrowed to 3 results for: puromycin selection marker

Showing: 1 - 3 of 3 results
  1. Sequencing Primers

    Type
    Guide
    ...promoter Forward pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Forward...3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance...
  2. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...gamma-retroviral vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic...Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells ...& Burgess, S. M. (2014). MLV integration site selection is driven by strong enhancers and active promoters...
  3. Lentiviral Vector Guide

    Type
    Guide
    ...type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead... Many lentiviral vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic...Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells ...
Showing: 1 - 3 of 3 results