We narrowed to 3 results for: ubiquitin plasmid

...Expression Plasmids 101: The Promoter Region — Let's Go! Plasmids 101: Inducible Promoters Plasmids 101: Repressible...Repressible Promoters Plasmids 101: Terminators and PolyA signals More Plasmids 101 topics Content last...often incorporate the following promoters into plasmids to drive constitutive or inducible expression....Constitutive Plant High-expression promoter from maize ubiquitin gene GDS Constitutive Yeast Very strong promoter...

...mainly uses next-generation sequencing (NGS) for plasmid verification, Addgene has used a number of primers...useful in your sequencing reaction, find your plasmid’s page and see what primers are listed under "5'...questions about choosing the best primer for your plasmid? Email us at [email protected] . For additional ...additional information on molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular ... Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F TGGCTCTCCTCAAGCGTATT...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT 5' end of...

...You may also like... Plasmid Kits Blog: Plasmids 101 Modular Cloning Blog: Plasmids 101 Modular Cloning...Applications and Kits Blog: Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning (or MoClo...functional plasmids. It is a powerful and very efficient method for creating many plasmids from different...Parrott 48 plasmids compatible with the GreenGate Cloning System (Lohmann) to create plasmids with multi-gene...Expression Tomáš Pluskal Plasmid kit for assembly of single-gene and multigene plasmids for genome integration... with plasmids from the MoClo-YTK . MoClo Pichia Toolkit Yeast Expression Volker Sieber Plasmids with ...Bacterial Expression Marco Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms...