Skip to main content

We narrowed to 7 results for: yeast

Showing: 1 - 7 of 7 results
  1. Modular Cloning Guide

    Type
    Guide
    ...biosensors in yeast (requires MoClo-YTK parts for use). Yeast GoldenBraid Cloning System and Toolkit Yeast Expression...for S. cerevisiae expression. Multiplex Yeast Toolkit (MYT) Yeast Expression, CRISPR Tom Ellis 96 plasmids...Aspergillus species. MoClo Yeast Secretion and Display (YSD) Toolkit Yeast Expression Paul Young 34 plasmids...surface display of proteins of interest. Yeast Secrete and Detect Yeast Expression Sylvestre Marillonnet Plasmids...secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). POMBOX MoClo YTK Yeast Expression...transcription units in the oleaginous yeast Y. lipolytica . EXPRESSYALI Yeast Expression Irina Borodina Plasmids...into Y. lipolytica chromosomal loci. Yeast GPCR-sensor Toolkit Yeast Expression Tom Ellis Plasmids for constructing...
  2. Molecular Cloning Techniques

    Type
    Guide
    ...Created with BioRender.com. Yeast-mediated Cloning and Oligonucleotide Stitching Yeast-mediated cloning is very...powerful recombination abilities of yeast. By simply transforming into yeast two (or more) fragments of dsDNA... cost-saver for labs working with yeast. Figure 7: Summary of yeast-mediated plasmid cloning and oligonucleotide...Golden Gate & MoClo Ligation Independent Cloning Yeast-Mediated & Oligo Stitching Resources Molecular cloning...manner. To accomplish this, you can transform into yeast the fragments of DNA to be fused along with custom...
  3. Promoters

    Type
    Guide
    ... also called TDH3 or GAPDH TEF1 Constitutive Yeast Yeast transcription elongation factor promoter TRE ...Specific Insect Requires UAS regulatory element and yeast Gal4 gene; often used in Drosophila Polyhedrin Constitutive...promoter from maize ubiquitin gene GDS Constitutive Yeast Very strong promoter from glyceraldehyde 3-phosphage...
  4. Guide to Using Pooled Libraries

    Type
    Guide
    ...a host cell or virus, such as bacteriophages or yeast. Surface display libraries are useful for epitope...screened for binding affinity to a target molecule. Yeast Display: In this system, proteins are displayed ...
  5. Sequencing Primers

    Type
    Guide
    ...Forward pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT...
  6. Molecular Biology Reference

    Type
    Guide
    ...drive expression in various cell types (mammalian, yeast, bacterial, etc.), depending largely on which promoter...
  7. CRISPR Guide

    Type
    Guide
    ...libraries are also available, such as those for yeast or Drosophila . Although CRISPR has been less widely...SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology , 36 (3), 265–271. PMID: 29431739...
Showing: 1 - 7 of 7 results