We narrowed to 4 results for: yeast
-
TypeGuide...protocol ) Back to Top Yeast-mediated Cloning and Oligonucleotide Stitching Yeast-mediated cloning is very...advantage of the powerful recombination abilities of yeast. Similar to Gibson, this method can efficiently ...accomplish this, you just need to introduce into the yeast the two (or more) fragments of DNA that you would...be set up to grow, transform and purify DNA from yeast. Back to Top...
-
Sequencing Primers
TypeGuide...primer pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT... -
Molecular Biology Reference
TypeGuide...drive expression in various cell types (mammalian, yeast, bacterial, etc.), depending largely on which promoter... -
CRISPR Guide
TypeGuide...libraries are also available, such as those for yeast or drosophila . Although CRISPR has been less widely...SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology , 36 (3), 265–271. PMID: 29431739...