Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 5 results for: yeast

Showing: 1 - 5 of 5 results

  1. Modular Cloning Guide

    Type
    Guide
    ...biosensors in yeast (requires MoClo-YTK parts for use). Yeast GoldenBraid Cloning System and Toolkit Yeast Expression...for S. cerevisiae expression. Multiplex Yeast Toolkit (MYT) Yeast Expression, CRISPR Tom Ellis 96 plasmids...Aspergillus species. MoClo Yeast Secretion and Display (YSD) Toolkit Yeast Expression Paul Young 34 plasmids...surface display of proteins of interest. Yeast Secrete and Detect Yeast Expression Sylvestre Marillonnet Plasmids...secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). POMBOX MoClo YTK Yeast Expression...transcription units in the oleaginous yeast Y. lipolytica . EXPRESSYALI Yeast Expression Irina Borodina Plasmids...into Y. lipolytica chromosomal loci. Yeast GPCR-sensor Toolkit Yeast Expression Tom Ellis Plasmids for constructing...

  2. Cloning

    Type
    Guide
    ...protocol ) Back to Top Yeast-mediated Cloning and Oligonucleotide Stitching Yeast-mediated cloning is very...advantage of the powerful recombination abilities of yeast. Similar to Gibson, this method can efficiently ...accomplish this, you just need to introduce into the yeast the two (or more) fragments of DNA that you would...be set up to grow, transform and purify DNA from yeast. Back to Top...

  3. Sequencing Primers

    Type
    Guide
    ...primer pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT...

  4. Molecular Biology Reference

    Type
    Guide
    ...drive expression in various cell types (mammalian, yeast, bacterial, etc.), depending largely on which promoter...

  5. CRISPR Guide

    Type
    Guide
    ...libraries are also available, such as those for yeast or drosophila . Although CRISPR has been less widely...SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology , 36 (3), 265–271. PMID: 29431739...
Showing: 1 - 5 of 5 results