Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pGEX-4T1
Source/Vendor: | Amersham |
Alt Name: | pGEX-4T-1 |
Analyze: | Sequence |
Plasmid Type: | Bacterial Expression |
Promotor: | tac |
Cloning Method: | Unknown |
Size: | 4969 |
5' Sequencing 1 Primer: | pGEX5' |
5' Sequencing 1 Primer Sequence: | GGGCTGGCAAGCCACGTTTGGTG |
Tag 1: | GST (Nterm) |
Tag 2: | thrombin site |
Bacterial Resistance: | Ampicillin |
Notes: | thrombin or factor Xa protease sites to cleave protein from fusion. pGEX-1lambdaT, pGEX-4T-1, pGEX-5X-1 accept cDNA from lambda gt11 libs. Hosts: E.coli. Related vectors: pGEX-2T. (Information source: <a href=http://seq.yeastgenome.org/vectordb target=_blank>VectorDB</a>.) |
Catalog Number: | 27458001 |
GenBank: | M21676, M97937 |
Stable: | Unspecified |
Constitutive: | Unspecified |
Viral/Non-Viral: | Nonviral |