Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pGL3-Control
| Source/Vendor: | Promega |
| Analyze: | Sequence |
| Plasmid Type: | Luciferase |
| Promotor: | SV40 |
| Cloning Method: | Unknown |
| Size: | 5256 |
| 5' Sequencing 1 Primer: | RVprimer3 |
| 5' Sequencing 1 Primer Sequence: | CTAGCAAAATAGGCTGTCCC |
| Bacterial Resistance: | Ampicillin |
| Notes: | Luciferase Reporter Vector. For more information, see http://www.promega.com/vectors/cloning_vectors.htm#b05
Control vector with the SV40 enhancer and promoter driving strong luciferase expression.
|
| Catalog Number: | E1741 |
| GenBank: | U47296 |
| Stable: | Unspecified |
| Constitutive: | Unspecified |
| Viral/Non-Viral: | Nonviral |