Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pCDFDuet-1
Source/Vendor: | Novagen (EMD Millipore) |
Alt Name: | pCDFDuet™-1 |
Analyze: | Sequence |
Plasmid Type: | Bacterial Expression |
Promotor: | AmpR |
Expression Level: | Unknown |
Cloning Method: | Restriction Enzyme |
Size: | 3781 |
5' Sequencing 1 Primer: | ACYCDuetUP1 |
5' Sequencing 1 Primer Sequence: | GGATCTCGACGCTCTCCCT |
3' Sequencing 1 Primer: | DuetDOWN1 |
3' Sequencing 1 Primer Sequence: | GATTATGCGGCCGTGTACAA |
5' Sequencing 2 Primer: | DuetUP2 |
5' Sequencing 2 Primer Sequence: | TTGTACACGGCCGCATAATC |
3' Sequencing 2 Primer: | T7term |
3' Sequencing 2 Primer Sequence: | GCTAGTTATTGCTCAGCGG |
5' Terminal: | N-Term |
5' Terminal 2: | N-Term |
3' Terminal: | C-Term |
3' Terminal 2: | C-Term |
Tag 1: | 6xHis |
Tag 2: | S15 |
Bacterial Resistance: | Streptomycin |
Notes: | pCDFDuet™-1 is designed for the coexpression of two target genes. The vector encodes two multiple cloning sites (MCS) each of which is preceded by a T7 promoter, lac operator, and ribosome binding site (rbs). The vector also carries the pCloDF13 replicon, lacI gene and streptomycin/spectinomycin resistance marker. This vector can be transformed into the same cell with pETDuet™-1, pACYCDuet™-1, and pRSFDuet™-1 or pCOLADuet™-1 for the coexpression of up to eight target genes. ORFs inserted into MCS-1 can be sequenced using the ACYCDuetUP1 Primer and DuetDOWN1 Primer. ORFs inserted into MCS-2 can be sequenced using the DuetUP2 Primer and T7 Terminator Primer. |
Stable: | Unspecified |
Constitutive: | Unspecified |
Viral/Non-Viral: | Nonviral |