Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Vector Database

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

This vector is NOT available from Addgene.

Plasmid: pCDFDuet-1

Source/Vendor: Novagen (EMD Millipore)
Alt Name: pCDFDuet™-1
Analyze: Sequence
Plasmid Type: Bacterial Expression
Promotor: AmpR
Expression Level: Unknown
Cloning Method: Restriction Enzyme
Size: 3781
5' Sequencing 1 Primer: ACYCDuetUP1
5' Sequencing 1 Primer Sequence: GGATCTCGACGCTCTCCCT
3' Sequencing 1 Primer: DuetDOWN1
3' Sequencing 1 Primer Sequence: GATTATGCGGCCGTGTACAA
5' Sequencing 2 Primer: DuetUP2
5' Sequencing 2 Primer Sequence: TTGTACACGGCCGCATAATC
3' Sequencing 2 Primer: T7term
3' Sequencing 2 Primer Sequence: GCTAGTTATTGCTCAGCGG
5' Terminal: N-Term
5' Terminal 2: N-Term
3' Terminal: C-Term
3' Terminal 2: C-Term
Tag 1: 6xHis
Tag 2: S15
Bacterial Resistance: Streptomycin
pCDFDuet™-1 is designed for the coexpression of two target genes. The vector encodes two multiple cloning sites (MCS) each of which is preceded by a T7 promoter, lac operator, and ribosome binding site (rbs). The vector also carries the pCloDF13 replicon, lacI gene and streptomycin/spectinomycin resistance marker. This vector can be transformed into the same cell with pETDuet™-1, pACYCDuet™-1, and pRSFDuet™-1 or pCOLADuet™-1 for the coexpression of up to eight target genes. ORFs inserted into MCS-1 can be sequenced using the ACYCDuetUP1 Primer and DuetDOWN1 Primer. ORFs inserted into MCS-2 can be sequenced using the DuetUP2 Primer and T7 Terminator Primer.
Stable: Unspecified
Constitutive: Unspecified
Viral/Non-Viral: Nonviral

Generated Plasmid Map
