Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pCDFDuet-1
Information
- Source/Vendor
- Novagen (EMD Millipore)
- Alt Name
- pCDFDuet™-1
- Plasmid Type
- Bacterial Expression
- Promoter
- AmpR
- Expression Level
- Unknown
- Cloning Method
- Restriction Enzyme
- Size
- 3781
- 5' Sequencing 1 Primer
- ACYCDuetUP1
- 5' Sequencing 1 Primer Sequence
- GGATCTCGACGCTCTCCCT
- 3' Sequencing 1 Primer
- DuetDOWN1
- 3' Sequencing 1 Primer Sequence
- GATTATGCGGCCGTGTACAA
- 5' Sequencing 2 Primer
- DuetUP2
- 5' Sequencing 2 Primer Sequence
- TTGTACACGGCCGCATAATC
- 3' Sequencing 2 Primer
- T7term
- 3' Sequencing 2 Primer Sequence
- GCTAGTTATTGCTCAGCGG
- 5' Terminal
- N-Term
- 5' Terminal 2
- N-Term
- 3' Terminal
- C-Term
- 3' Terminal 2
- C-Term
- Tag 1
- 6xHis
- Tag 2
- S15
- Bacterial Resistance
- Streptomycin
- Notes
- pCDFDuet™-1 is designed for the coexpression of two target genes. The vector encodes two multiple cloning sites (MCS) each of which is preceded by a T7 promoter, lac operator, and ribosome binding site (rbs). The vector also carries the pCloDF13 replicon, lacI gene and streptomycin/spectinomycin resistance marker. This vector can be transformed into the same cell with pETDuet™-1, pACYCDuet™-1, and pRSFDuet™-1 or pCOLADuet™-1 for the coexpression of up to eight target genes. ORFs inserted into MCS-1 can be sequenced using the ACYCDuetUP1 Primer and DuetDOWN1 Primer. ORFs inserted into MCS-2 can be sequenced using the DuetUP2 Primer and T7 Terminator Primer.
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral