1,779 results
-
Plasmid#1495DepositorTypeEmpty backboneTagsIVSA, rf2204, gfpN, IVSR, gfpS65C, IVSS, IVST, gf…ExpressionWormAvailable SinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only
-
pDD162 (Peft-3::Cas9 + Empty sgRNA)
Plasmid#47549PurposeCas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome.DepositorInsertsCas9
Empty sgRNA
UseCRISPRTagsHA and NLSExpressionWormMutationCodon optimized and with synthetic introns for C.…PromoterU6 and eef-1A.1 (eft-3)Available SinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDD268
Plasmid#132523PurposemNG^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertmNG-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized mNGExpressionWormAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
L4440
Plasmid#1654DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRNAiTagsT7p, T7p, lacZN, OriF1>>, OriF1<<ExpressionWormAvailable SinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
GFP::L4440
Plasmid#11335DepositorInsertGFP
UseRNAiExpressionWormAvailable SinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSM-mStayGold
Plasmid#234317Purposecodon-optimized mStayGold with synthetic introns for the expression in C. elegansDepositorInsertC. elegans codon optimized mStayGOld
TagsmStayGoldExpressionWormAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHIP_RNA1
Plasmid#61259PurposeOrsay virus RNA1 genome segment expression plasmid for virus reverse geneticsDepositorInsertOrsay RNA1
ExpressionWormPromoterheat shock promoterAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHIP_RNA2
Plasmid#61260PurposeOrsay virus RNA2 genome segment expression plasmid for virus reverse geneticsDepositorInsertOrsay RNA2
ExpressionWormPromoterheat shock promoterAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDACR3882 [rab-3p::HYlight::let-858utr]
Plasmid#207666PurposeExpresses worm-optimized HYlight in C. elegans neuronsDepositorInsertHYlight Biosensor
ExpressionWormPromoterrab-3Available SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDACR3883 [rab-3p::HYlight-RA::let-858utr]
Plasmid#207667PurposeExpresses HYlight-RA, the negative control HYlight variant with reduced binding affinity, in C. elegans neuronsDepositorInsertHYlight-RA [T152E]
ExpressionWormPromoterrab-3Available SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZCS16 (Peft-3::wrmScarlet::tbb-2 3'UTR in pUC19)
Plasmid#154824Purpose(eft-3p::wrmScarlet::tbb-2 3'UTR in pUC19) Experimentally used to mark formation of transgenic arrays for C. elegansDepositorInsertPeft-3::wrmScarlet::tbb-2 UTR
ExpressionWormPromotereef-1A.1 (eft-3)Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS81(rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGR∆)
Plasmid#154840PurposeInsertion of rpl-28p::mKate2::unc-54 3'UTR into a split hygromycin landing pad. Can be modified to insert a different gene(s) of interest.DepositorInserthomology arm:rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGR∆
UseCRISPR and Cre/LoxExpressionWormMutationHYGR∆ encodes aa 1-226Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS79 (eft-3p::Cas9 + sgRNA)
Plasmid#154839PurposeCas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGGDepositorInsertsgRNA
UseCRISPRExpressionWormAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wElectra2
Plasmid#184933PurposeCodon optimized blue fluorescent protein Electra2 in C.elegans expresison plasmidDepositorInsertElectra2
ExpressionWormPromotertag-168Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
AID-mTagBFP2-loxP_myo2_neoR-loxP
Plasmid#194055PurposeDual-selection cassette plasmid for knocking-in AID-mTagBFP2 into the C. elegans genomeDepositorAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSKI
Plasmid#232484PurposepSKI can be used for single-copy transgene expression within the SKI PLACE System or for extrachromosomal arrays. It contains an MCS with 47 single cuts and two synthetic 900 bp homology arms.DepositorInsertpSKI
ExpressionWormAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only