-
PurposePlant expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting cpEGFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100024 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGPTVII-Bar-U
- Backbone size w/o insert (bp) 11751
- Total vector size (bp) 13710
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMatryoshCaMP6s
-
Alt nameGCaMP6s-LSSmOrange
-
Alt nameMCaMP6s
-
Insert Size (bp)1959
- Promoter AtUBQ10
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGATTTGTGATTTCTATCTAGATCTGG
- 3′ sequencing primer CACAAACTTAAGCACACAAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe GCaMP6s portion was derived from Addgene plasmid #40753 (Douglas Kim). The vector backbone was provided by Melanie Krebs, University of Heidelberg.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGPTVII-Bar-U-MatryoshCaMP6s was a gift from Wolf Frommer (Addgene plasmid # 100024 ; http://n2t.net/addgene:100024 ; RRID:Addgene_100024) -
For your References section:
Ratiometric Matryoshka biosensors from a nested cassette of green- and orange-emitting fluorescent proteins. Ast C, Foret J, Oltrogge LM, De Michele R, Kleist TJ, Ho CH, Frommer WB. Nat Commun. 2017 Sep 5;8(1):431. doi: 10.1038/s41467-017-00400-2. 10.1038/s41467-017-00400-2 [pii] PubMed 28874729