Skip to main content

pHis-hPim1
(Plasmid #100722)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100722 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 6750
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Pim1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    852
  • Mutation
    Residues 29-313 of isoform 2
  • Entrez Gene
    PIM1 (a.k.a. PIM)
  • Promoter T7 promotor
  • Tag / Fusion Protein
    • His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter primer)
  • 3′ sequencing primer CCGCTGAGCAATAACTAGC (T7 terminator primer)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHis-hPim1 was a gift from Byung Il Lee (Addgene plasmid # 100722 ; http://n2t.net/addgene:100722 ; RRID:Addgene_100722)
  • For your References section:

    Crystal structure of pim1 kinase in complex with a pyrido[4,3-d]pyrimidine derivative suggests a unique binding mode. Lee SJ, Han BG, Cho JW, Choi JS, Lee J, Song HJ, Koh JS, Lee BI. PLoS One. 2013 Jul 31;8(7):e70358. doi: 10.1371/journal.pone.0070358. Print 2013. PONE-D-13-13556 [pii] PubMed 23936194