pHis-hPim1
(Plasmid
#100722)
-
PurposeExpression of human Pim1 kinase domain in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100722 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 6750
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePim1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)852
-
MutationResidues 29-313 of isoform 2
-
Entrez GenePIM1 (a.k.a. PIM)
- Promoter T7 promotor
-
Tag
/ Fusion Protein
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter primer)
- 3′ sequencing primer CCGCTGAGCAATAACTAGC (T7 terminator primer) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHis-hPim1 was a gift from Byung Il Lee (Addgene plasmid # 100722 ; http://n2t.net/addgene:100722 ; RRID:Addgene_100722) -
For your References section:
Crystal structure of pim1 kinase in complex with a pyrido[4,3-d]pyrimidine derivative suggests a unique binding mode. Lee SJ, Han BG, Cho JW, Choi JS, Lee J, Song HJ, Koh JS, Lee BI. PLoS One. 2013 Jul 31;8(7):e70358. doi: 10.1371/journal.pone.0070358. Print 2013. PONE-D-13-13556 [pii] PubMed 23936194