Skip to main content

pcrDNA3.1-Chimera
(Plasmid #100891)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100891 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCR3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6241
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Major Fibrolamellar hepatocellular carcinoma Chimera
  • Alt name
    Exon 1 of DNAJB1- Exon 2-Exon 10 of PRKACA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1221
  • Entrez Gene
    DNAJB1 (a.k.a. HSPF1, Hdj1, Hsp40, RSPH16B, Sis1)
  • Entrez Gene
    PRKACA (a.k.a. CAFD1, PKACA, PPNAD4)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert was artificially synthesized based on the major chimeric sequence found in patients

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcrDNA3.1-Chimera was a gift from Sanford Simon (Addgene plasmid # 100891 ; http://n2t.net/addgene:100891 ; RRID:Addgene_100891)
  • For your References section:

    Detection of a recurrent DNAJB1-PRKACA chimeric transcript in fibrolamellar hepatocellular carcinoma. Honeyman JN, Simon EP, Robine N, Chiaroni-Clarke R, Darcy DG, Lim II, Gleason CE, Murphy JM, Rosenberg BR, Teegan L, Takacs CN, Botero S, Belote R, Germer S, Emde AK, Vacic V, Bhanot U, LaQuaglia MP, Simon SM. Science. 2014 Feb 28;343(6174):1010-4. doi: 10.1126/science.1249484. 10.1126/science.1249484 PubMed 24578576