This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24th & 25th and December 31st & January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDRF'- AmTryoshka1;3-LS-F138I-T78H
(Plasmid #100963)


Item Catalog # Description Quantity Price (USD)
Plasmid 100963 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6939
  • Total vector size (bp) 9869
  • Vector type
    Yeast Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
  • Mutation
    F138I, T78H
  • Entrez Gene
    AMT1;3 (a.k.a. AT3G24300, AMMONIUM TRANSPORTER 1;3, ATAMT1;3, ammonium transporter 1;3)
  • Promoter PMA

Cloning Information

  • Cloning method Gateway Cloning
  • 3′ sequencing primer GAAGTGTCAACAACGTATCTACC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDRF'- AmTryoshka1;3-LS-F138I-T78H was a gift from Wolf Frommer (Addgene plasmid # 100963 ; ; RRID:Addgene_100963)
  • For your References section:

    Ratiometric Matryoshka biosensors from a nested cassette of green- and orange-emitting fluorescent proteins. Ast C, Foret J, Oltrogge LM, De Michele R, Kleist TJ, Ho CH, Frommer WB. Nat Commun. 2017 Sep 5;8(1):431. doi: 10.1038/s41467-017-00400-2. 10.1038/s41467-017-00400-2 [pii] PubMed 28874729