pGL4.18 NR0B1-Luc
(Plasmid
#100983)
-
PurposeNR0B1 luciferase reporter - firefly luciferase driven by NR0B1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100983 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL4.18
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNR0B1
-
SpeciesH. sapiens (human)
-
Entrez GeneNR0B1 (a.k.a. AHC, AHCH, AHX, DAX-1, DAX1, DSS, GTD, HHG, NROB1, SRXY2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer GACGATAGTCATGCCCCGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.18 NR0B1-Luc was a gift from Lee Helman (Addgene plasmid # 100983 ; http://n2t.net/addgene:100983 ; RRID:Addgene_100983) -
For your References section:
Identification of an inhibitor of the EWS-FLI1 oncogenic transcription factor by high-throughput screening. Grohar PJ, Woldemichael GM, Griffin LB, Mendoza A, Chen QR, Yeung C, Currier DG, Davis S, Khanna C, Khan J, McMahon JB, Helman LJ. J Natl Cancer Inst. 2011 Jun 22;103(12):962-78. doi: 10.1093/jnci/djr156. Epub 2011 Jun 8. 10.1093/jnci/djr156 PubMed 21653923