Skip to main content

eSpCas9(1.1)-T2A-Puro
(Plasmid #101039)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101039 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    eSpCas9(1.1)
  • Backbone manufacturer
    Feng Zhang lab
  • Backbone size (bp) 8506
  • Modifications to backbone
    Addition of T2A linker and Puromycin Resistance
  • Vector type
    Mammalian Expression, CRISPR
  • Promoter CBh
  • Selectable markers
    Puromycin
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • T2A-Puro (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    eSpCas9(1.1) was a gift from Feng Zhang (Addgene plasmid # 71814)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9(1.1)-T2A-Puro was a gift from Andrea Németh (Addgene plasmid # 101039 ; http://n2t.net/addgene:101039 ; RRID:Addgene_101039)