-
Purpose(Empty Backbone) Enhanced SpCas9(1.1) with puromycin resistance gene via T2A linker.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101039 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneeSpCas9(1.1)
-
Backbone manufacturerFeng Zhang lab
- Backbone size (bp) 8506
-
Modifications to backboneAddition of T2A linker and Puromycin Resistance
-
Vector typeMammalian Expression, CRISPR
- Promoter CBh
-
Selectable markersPuromycin
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- T2A-Puro (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byeSpCas9(1.1) was a gift from Feng Zhang (Addgene plasmid # 71814)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eSpCas9(1.1)-T2A-Puro was a gift from Andrea Németh (Addgene plasmid # 101039 ; http://n2t.net/addgene:101039 ; RRID:Addgene_101039)