Skip to main content
Addgene

pSNAPf-H2B Control Plasmid
(Plasmid #101124)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101124 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pSNAP
  • Backbone size w/o insert (bp) 5858
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    histone cluster 1 H2B family member j
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    378
  • Entrez Gene
    H2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
  • Promoter CMV
  • Tag / Fusion Protein
    • SNAP-tag (SNAPf) (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer GACGCAAATGGGCGGTAG (CMV Forward Primer)
  • 3′ sequencing primer AGGGAGTACTCACCCCAACA (ST1 Reverse Primer)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Originally cloned at New England Biolabs. The H2B insert is a N-terminal insert.

This plasmid is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). For more information about commercial rights, please contact NEB's Global Business Development team at [email protected]. For more information on this plasmid, please see https://www.addgene.org/depositor-collections/neb-cell-imaging-tags/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSNAPf-H2B Control Plasmid was a gift from New England Biolabs & Ana Egana (Addgene plasmid # 101124 ; http://n2t.net/addgene:101124 ; RRID:Addgene_101124)