Skip to main content

sg14x(MS2) MUC4.1
(Plasmid #101153)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101153 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSico
  • Total vector size (bp) 8370
  • Modifications to backbone
    none
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin ; BFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MUC4
  • gRNA/shRNA sequence
    GTAAAGTAGAAAAGGCATAAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    MUC4 (a.k.a. ASGP, HSA276359, MUC-4)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sg14x(MS2) MUC4.1 was a gift from Mazhar Adli (Addgene plasmid # 101153 ; http://n2t.net/addgene:101153 ; RRID:Addgene_101153)
  • For your References section:

    Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9. Qin P, Parlak M, Kuscu C, Bandaria J, Mir M, Szlachta K, Singh R, Darzacq X, Yildiz A, Adli M. Nat Commun. 2017 Mar 14;8:14725. doi: 10.1038/ncomms14725. 10.1038/ncomms14725 PubMed 28290446