Skip to main content
Addgene

pVC-Ds-E1b:eGFP-Ds
(Plasmid #102417)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102417 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Unknown
  • Backbone size w/o insert (bp) 3873
  • Total vector size (bp) 5338
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E1b:eGFP
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1465
  • Promoter Zebrafish E1b minimal promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATCCCGTACCGACCGTTATC
  • 3′ sequencing primer GGTAATGGTAGCGACCGGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Plasmid #37846 (N. Ahituv) and parts of plasmid obtained directly from the authors listed, via MTA dated 27th August 2012.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A. Emelyanov and S. Parinov. Mifepristone-inducible LexPR system to drive and control gene expression in transgenic zebrafish. Developmental Biology, 320(1):113– 121, 2008. ISSN 00121606. doi: 10.1016/j.ydbio.2008.04.042.

A. Emelyanov, Y. Gao, N. I. Naqvi, and S. Parinov. Trans-kingdom transposition of the maize Dissociation element. Genetics, 174(3):1095–1104, 2006. ISSN 00166731. doi: 10.1534/genetics.106.061184.

Please visit https://www.biorxiv.org/content/10.1101/450684v2 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVC-Ds-E1b:eGFP-Ds was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 102417 ; http://n2t.net/addgene:102417 ; RRID:Addgene_102417)
  • For your References section:

    Ac/Ds transposition for CRISPR/dCas9-SID4x epigenome modulation in zebrafish. Chong-Morrison V, Mayes S, Simoes FC, Senanayake U, Carroll DS, Riley PR, Wilson SW, Sauka-Spengler T. Biol Open. 2023 Jun 15;12(6):bio059995. doi: 10.1242/bio.059995. Epub 2023 Jun 27. 10.1242/bio.059995 PubMed 37367831