pLJC5-Flag-SAMTOR
(Plasmid
#102420)
-
Purpose3rd generation lentiviral vector expressing FLAG SAMTOR in mammalian cells driven by UBC promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102420 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLJC5
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSAMTOR
-
Alt nameC7orf60
-
SpeciesH. sapiens (human)
-
GenBank IDNM_152556.2
-
Entrez GeneBMT2 (a.k.a. C7orf60)
- Promoter UBC
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (destroyed during cloning)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer TAGGGTAGGCTCTCCTG
- 3′ sequencing primer GACGTGAAGAATGTGCGAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJC5-Flag-SAMTOR was a gift from David Sabatini (Addgene plasmid # 102420 ; http://n2t.net/addgene:102420 ; RRID:Addgene_102420) -
For your References section:
SAMTOR is an S-adenosylmethionine sensor for the mTORC1 pathway. Gu X, Orozco JM, Saxton RA, Condon KJ, Liu GY, Krawczyk PA, Scaria SM, Harper JW, Gygi SP, Sabatini DM. Science. 2017 Nov 10;358(6364):813-818. doi: 10.1126/science.aao3265. 10.1126/science.aao3265 PubMed 29123071