Skip to main content

STAGR_SAMScaffold_mU6
(Plasmid #102845)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102845 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PCR Template for STAgR Reactions
  • Backbone manufacturer
    Stricker Lab
  • Vector type
    PCR Template for STAgR Inserts

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    STAgR Insert SAM_mU6
  • Promoter mU6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTGGATCCGGTACCAAGG
  • 3′ sequencing primer TTACGGTTCCTGGCCTTTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    STAGR_SAMScaffold_mU6 was a gift from Stefan Stricker (Addgene plasmid # 102845 ; http://n2t.net/addgene:102845 ; RRID:Addgene_102845)
  • For your References section:

    One step generation of customizable gRNA vectors for multiplex CRISPR approaches through string assembly gRNA cloning (STAgR). Breunig CT, Durovic T, Neuner AM, Baumann V, Wiesbeck MF, Koferle A, Gotz M, Ninkovic J, Stricker SH. PLoS One. 2018 Apr 27;13(4):e0196015. doi: 10.1371/journal.pone.0196015. eCollection 2018. 10.1371/journal.pone.0196015 PubMed 29702666