pmTurqoise KIF1A shRNA
(Plasmid
#102849)
-
PurposeGenerates shRNA specific to Rat KIF1A along with cell fill pmTurqoise
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102849 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSuper
-
Backbone manufacturerOligoengine
- Backbone size w/o insert (bp) 5415
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKIF1A-shRNA
-
Alt nameATSV, Kns1
-
gRNA/shRNA sequenceTACCTATGTGAACGGCAAG
-
SpeciesR. norvegicus (rat)
-
Entrez GeneKIF1A
- Promoter H1-RNA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer T7 TAATACGACTCACTATAGGG , M13R CAGGAAACAGCTATGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The pmTurquoise KIF1A shRNA vector was constructed by restriction site removal of eGFP from the commercially available pSuper vector (Oligoengine) and insertion of the cDNA coding for pmTurquoise (Addgene plasmid #36202).
The reference for the pSuper Vector (Oligoengine) is T.R. Brummelkamp, R. Bernards, and R Agami, Science 296, 550 (2002).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmTurqoise KIF1A shRNA was a gift from Erik Dent (Addgene plasmid # 102849 ; http://n2t.net/addgene:102849 ; RRID:Addgene_102849) -
For your References section:
Transport of a kinesin-cargo pair along microtubules into dendritic spines undergoing synaptic plasticity. McVicker DP, Awe AM, Richters KE, Wilson RL, Cowdrey DA, Hu X, Chapman ER, Dent EW. Nat Commun. 2016 Sep 23;7:12741. doi: 10.1038/ncomms12741. 10.1038/ncomms12741 PubMed 27658622