Skip to main content

lentiCRISPR v2 kif26b sgRNA2
(Plasmid #102858)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102858 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Addgene #52961 (provided by Feng Zhang)
  • Backbone size w/o insert (bp) 14873
  • Total vector size (bp) 13012
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mouse Kif26b
  • gRNA/shRNA sequence
    GAACTGTAACGCCCGCTTGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Kif26b (a.k.a. 4832420M10, BC056349, D230039L06Rik)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmB1 (destroyed during cloning)
  • 3′ cloning site BsmB1 (destroyed during cloning)
  • 5′ sequencing primer cgatacaaggctgttagagag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2 kif26b sgRNA2 was a gift from Henry Ho (Addgene plasmid # 102858 ; http://n2t.net/addgene:102858 ; RRID:Addgene_102858)
  • For your References section:

    Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates. Susman MW, Karuna EP, Kunz RC, Gujral TS, Cantu AV, Choi SS, Jong BY, Okada K, Scales MK, Hum J, Hu LS, Kirschner MW, Nishinakamura R, Yamada S, Laird DJ, Jao LE, Gygi SP, Greenberg ME, Ho HH. Elife. 2017 Sep 8;6. pii: e26509. doi: 10.7554/eLife.26509. 10.7554/eLife.26509 PubMed 28885975