-
Purpose(Empty Backbone) PresentER with removable cassette for cloning of MHC-I antigen (mCherry version)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102943 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePresentER
- Backbone size (bp) 8200
-
Vector typeMammalian Expression, Retroviral
- Promoter LTR
-
Selectable markersPuromycin ; mCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GTTCGACCCCGCCTCGATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/09/22/267047 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PresentER-Cassette mCherry was a gift from David Scheinberg (Addgene plasmid # 102943 ; http://n2t.net/addgene:102943 ; RRID:Addgene_102943) -
For your References section:
Rejection of immunogenic tumor clones is limited by clonal fraction. Gejman RS, Chang AY, Jones HF, DiKun K, Hakimi AA, Schietinger A, Scheinberg DA. Elife. 2018 Nov 30;7. pii: 41090. doi: 10.7554/eLife.41090. 10.7554/eLife.41090 PubMed 30499773