-
PurposeExpresses FLAG-APEX2 in Saccharomyces cerevisiae under control of GAL1 promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS425
-
Backbone manufacturerATCC
- Backbone size w/o insert (bp) 7500
- Total vector size (bp) 8500
-
Modifications to backboneGAL1-inducible promoter / GAL4 terminator
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAPEX2-NES
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)786
-
GenBank IDAddgene Plasmid #49386
- Promoter GAL1
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTGTATTACTTCTTATTCAAATGTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH124 was a gift from Peter Espenshade (Addgene plasmid # 102951 ; http://n2t.net/addgene:102951 ; RRID:Addgene_102951) -
For your References section:
Proximity-dependent biotin labeling in yeast using the engineered ascorbate peroxidase APEX2. Hwang J, Espenshade PJ. Biochem J. 2016 Jun 7. pii: BCJ20160106. 10.1042/BCJ20160106 PubMed 27274088