pNB22
(Plasmid
#103059)
-
Purposemedium copy plasmid (pBR322 backbone) expressing the unstable GFP variant GFP-OVA under control of the nitric oxide-inducible promoter hmpAp
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 103059 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR322
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP-OVA
- Promoter hmpAp
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (unknown if destroyed)
- 3′ cloning site Xba 1 (unknown if destroyed)
- 5′ sequencing primer pBR322ori-F GGGAAACGCCTGGTATCTTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A short ovalbumin epitope (amino acids 319–343) was fused to GFP (pGFP_OVA) to follow the immune response to the expressed antigen. (Bumann, 2001).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNB22 was a gift from Dirk Bumann (Addgene plasmid # 103059 ; http://n2t.net/addgene:103059 ; RRID:Addgene_103059) -
For your References section:
Disparate impact of oxidative host defenses determines the fate of Salmonella during systemic infection in mice. Burton NA, Schurmann N, Casse O, Steeb AK, Claudi B, Zankl J, Schmidt A, Bumann D. Cell Host Microbe. 2014 Jan 15;15(1):72-83. doi: 10.1016/j.chom.2013.12.006. 10.1016/j.chom.2013.12.006 PubMed 24439899