pLenti-Crispr-V2-HMID.v1
(Plasmid
#103062)
-
PurposeLentiCrisprV2 with guide targeting V1-V5 GESTALT barcodes
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 103062 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9 plus expressed GESTALT V1-V5 guide
-
gRNA/shRNA sequenceGGCACTGCGGCTGGAGGTGG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer actatcatatgcttaccgtaac
- 3′ sequencing primer AGGCCGATGCTGTACTTCTTGTCC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from https://www.addgene.org/52961/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-Crispr-V2-HMID.v1 was a gift from Jay Shendure (Addgene plasmid # 103062 ; http://n2t.net/addgene:103062 ; RRID:Addgene_103062) -
For your References section:
Whole organism lineage tracing by combinatorial and cumulative genome editing. McKenna A, Findlay GM, Gagnon JA, Horwitz MS, Schier AF, Shendure J. Science. 2016 May 26. pii: aaf7907. 10.1126/science.aaf7907 PubMed 27229144