-
PurposeExpresses dCas9 fused to human HDAC3 with R265P mutation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 103786 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneplenti
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-HDAC3-R265P
-
Alt namehistone deacetylase 3
-
SpeciesH. sapiens (human), Synthetic; S. pyogenes
-
MutationChanged arginine 265 to proline
-
GenBank IDNM_003883
-
Entrez GeneHDAC3 (a.k.a. HD3, KDAC3, RPD3, RPD3-2)
- Promoter EF1A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer GTTTGGATCTTGGTTCATTCTCAAGCCTCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhuman HDAC3 cDNA from Addgene plasmid HDAC3-Flag (#13819) plenti vector containing dCas9_2A_Blast from Addgene plasmid (#61425)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The stop codon present after the HDAC3 open reading frame may interfere with expression of the blasticidin resistance cassette. Blasticidin selection has not been verified with this plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dCas-hHDAC3-R265P was a gift from Zhaolan Zhou (Addgene plasmid # 103786 ; http://n2t.net/addgene:103786 ; RRID:Addgene_103786) -
For your References section:
Locus-specific histone deacetylation using a synthetic CRISPR-Cas9-based HDAC. Kwon DY, Zhao YT, Lamonica JM, Zhou Z. Nat Commun. 2017 May 12;8:15315. doi: 10.1038/ncomms15315. 10.1038/ncomms15315 PubMed 28497787