-
PurposeCas9 mSA for in vitro transcription for gene editing in Mouse Embryos
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 103882 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePCS2+
- Backbone size w/o insert (bp) 4072
- Total vector size (bp) 8886
-
Modifications to backbonenone
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsnone
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAS9-MSA
-
Speciessynthetic
-
Insert Size (bp)4818
-
Mutationnone
- Promoter SP6
-
Tag
/ Fusion Protein
- MSA (monomeric streptavidin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn1 (not destroyed)
- 3′ cloning site destroyed (unknown if destroyed)
- 5′ sequencing primer ATTTAGGTGACACTAT
- 3′ sequencing primer CCTGTGTGAAATTGTTATCC
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byWe cloned this gene ourselves. But we used Cas9 sequence from px330 plasmid from add gene and the MSA sequence from pDisplay-mSA-EGFP-TM (Plasmid #39863)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
non
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PCS2+Cas9-mSA was a gift from Janet Rossant (Addgene plasmid # 103882 ; http://n2t.net/addgene:103882 ; RRID:Addgene_103882) -
For your References section:
Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Gu B, Posfai E, Rossant J. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. 10.1038/nbt.4166 PubMed 29889212