-
PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the CAG promoter, Cre mediated flip-excision switch
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
AAV1 | 104496-AAV1 | 100 µL at titer ≥ 7×10¹² vg/mL and Plasmid. | $405 | ||
AAV Retrograde | 104496-AAVrg | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $405 | ||
AAV PHP.eB | 104496-PHPeB | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $405 |
Don’t see the serotype you want?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV-CAG-FLEX
-
Backbone manufacturerScott Sternson
- Backbone size w/o insert (bp) 5027
- Total vector size (bp) 6380
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namejGCaMP7f
-
Alt nameGCaMP3-T302L R303P A317L D380Y
-
Alt nameGCaMP3 variant 921
-
Alt nameJanelia GCaMP7
-
SpeciesR. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
-
Insert Size (bp)1353
- Promoter CAG
-
Tag
/ Fusion Protein
- T7 epitope, Xpress tag, 6xHis
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/434589v1 for bioRxiv preprint.
Information for AAV1 (Catalog # 104496-AAV1) ( Back to top)
Purpose
Ready-to-use AAV1 particles produced from pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE (#104496). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE plasmid DNA.
CAG-driven, Cre-dependent jGCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Please note that this vector may have a higher level of recombination than our other FLEX vectors. We are making it available because it is still useful to some scientists, but understand that you may see expression in the absence of Cre.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
Information for AAV Retrograde (Catalog # 104496-AAVrg) ( Back to top)
Purpose
Ready-to-use AAV Retrograde particles produced from pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE (#104496). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE plasmid DNA.
CAG-driven, Cre-dependent jGCaMP7f calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
- Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype AAV retrograde (AAVrg)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
Information for AAV PHP.eB (Catalog # 104496-PHPeB) ( Back to top)
Purpose
Ready-to-use AAV PHP.eB particles produced from pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE (#104496). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE plasmid DNA.
CAG-driven, Cre-dependent jGCaMP7f calcium sensor. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
-
Packaging Plasmids
PHP.eB cap gene
pUCmini-iCAP-PHP.eB (plasmid #103005) - Buffer PBS + 0.001% Poloxamer 188
- Serotype PHPeB (plasmid #103005)
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
Citation Information: When using the PHP.eB serotype in future publications, please acknowledge Viviana Gradinaru and Benjamin Deverman and cite Chan et al., Nat Neurosci, 20(8):1172-1179. Pubmed.These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 104496 ; http://n2t.net/addgene:104496 ; RRID:Addgene_104496) For viral preps, please replace (Addgene plasmid # 104496) in the above sentence with: (Addgene viral prep # 104496-AAV1), (Addgene viral prep # 104496-AAVrg), or (Addgene viral prep # 104496-PHPeB) -
For your References section:
High-performance calcium sensors for imaging activity in neuronal populations and microcompartments. Dana H, Sun Y, Mohar B, Hulse BK, Kerlin AM, Hasseman JP, Tsegaye G, Tsang A, Wong A, Patel R, Macklin JJ, Chen Y, Konnerth A, Jayaraman V, Looger LL, Schreiter ER, Svoboda K, Kim DS. Nat Methods. 2019 Jul;16(7):649-657. doi: 10.1038/s41592-019-0435-6. Epub 2019 Jun 17. 10.1038/s41592-019-0435-6 PubMed 31209382