-
PurposeContains human IgG1 CH1/mutated CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Abolished Fc-mediated immune effector functions
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCEP4
-
Backbone manufacturerInvitrogen (Thermo Fisher)
- Backbone size w/o insert (bp) 10143
- Total vector size (bp) 11229
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions250 rpm
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman IgG1 CH1/CH2/CH3 (mutated, no effector functions)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1086
-
MutationL234A/L235E/G237A and K322A/P331S
-
Entrez GeneIGHG1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GAGGTCTATATAAGCAGAGC
- 3′ sequencing primer GCTTATAATGGTTACAAATAAAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS results found A250G, A253G, A258G, A295G, A297G, and A300G within the EBNA1 translation on the pCEP4 backbone compared to YP_401677.1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRVL-6 was a gift from Daniel Christ (Addgene plasmid # 104584 ; http://n2t.net/addgene:104584 ; RRID:Addgene_104584) -
For your References section:
Expression of IgG Monoclonals with Engineered Immune Effector Functions. Vazquez-Lombardi R, Nevoltris D, Rouet R, Christ D. Methods Mol Biol. 2018;1827:313-334. doi: 10.1007/978-1-4939-8648-4_16. 10.1007/978-1-4939-8648-4_16 PubMed 30196504