Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


lenti-SpCas9 neo
(Plasmid #104996)


This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104996 Standard format: Plasmid sent in bacteria as agar stab 1 $85


  • Vector backbone
    lentiCRISPRv2 neo (Addgene #98292)
  • Backbone manufacturer
    Brett Stringer from Feng Zhang plasmid lentiCRISPR v2 (Addgene plasmid #52961)
  • Total vector size (bp) 12866
  • Modifications to backbone
    The first of the two MluI restriction sites of lentiCRISPR v2 (Addgene plasmid #52961) was mutated (to create lentiCRISPRv2 puro, Addgene plasmid #98290) to allow the subcloning of alternative P2A-antibiotic resistance cassettes between the BamHI and remaining MluI restriction site (see also lentiCRISPRv2 hygro, Addgene plasmid #98291; lentiCRISPRv2 neo, Addgene plasmid #98292; and lentiCRISPRv2 blast, Addgene plasmid #98293). The U6 promoter-2 kb BsmBI-BsmBI filler cassette of lentiCRISPRv2 neo (Addgene plasmid #98292) was removed by KpnI/NheI digestion a KpnI-XhoI-BsrGI-NheI double-stranded oligonucleotide sequence was cloned in its place between the KpnI and NheI restriction sites (see also lentiCas9 puro, Addgene plasmid #104994; lentiCas9 hygro, Addgene plasmid #104995; and lentiCas9 blast, Addgene plasmid #104997).
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Single colonies of transformed STBL3 or STBL4 cells cultured in 5 ml of LB broth containing 100 micrograms/ml ampicillin for 20 hours at 37C, 200 rpm give good yields for plasmid minipreps.
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer acagtgcaggggaaagaatagtaga
  • 3′ sequencing primer aagcagcgtatccacatagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Feng Zhang (Addgene plasmid # 52961)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti-SpCas9 neo was a gift from Brett Stringer (Addgene plasmid # 104996 ; ; RRID:Addgene_104996)
  • For your References section:

    A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Stringer BW, Day BW, D'Souza RCJ, Jamieson PR, Ensbey KS, Bruce ZC, Lim YC, Goasdoue K, Offenhauser C, Akgul S, Allan S, Robertson T, Lucas P, Tollesson G, Campbell S, Winter C, Do H, Dobrovic A, Inglis PL, Jeffree RL, Johns TG, Boyd AW. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. 10.1038/s41598-019-41277-z PubMed 30894629