Skip to main content
Addgene
Open Menu

Ypet-RBD
(Plasmid #105291)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105291 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 105291-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 105291-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pYPet-C1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RBD
  • Alt name
    Rtkn
  • Species
    M. musculus (mouse)
  • Mutation
    aa encoding 7-89
  • Entrez Gene
    Rtkn
  • Tag / Fusion Protein
    • Ypet (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Subcloned the sequence encoding amino acids 7-89 (an additional nucleotide (T) to the 5' end keep it in frame) of mouse Rhotekin into the EcoRI-BamH1 sites of pYPet-C1. The insert was from Dr. Natalie Lamarche-Vane (McGill University).

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ypet-RBD was a gift from Kenneth Yamada (Addgene plasmid # 105291 ; http://n2t.net/addgene:105291 ; RRID:Addgene_105291)

  • For your References section:

    Nonpolarized signaling reveals two distinct modes of 3D cell migration. Petrie RJ, Gavara N, Chadwick RS, Yamada KM. J Cell Biol. 2012 Apr 30;197(3):439-55. doi: 10.1083/jcb.201201124. 10.1083/jcb.201201124 PubMed 22547408
Related items:
Commonly requested with: