Ypet-RBD
(Plasmid
#105291)
-
PurposeTo measure Rho activity by binding and FRET analysis
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105291 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYPet-C1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRBD
-
Alt nameRtkn
-
SpeciesM. musculus (mouse)
-
Mutationaa encoding 7-89
-
Entrez GeneRtkn
-
Tag
/ Fusion Protein
- Ypet (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Subcloned the sequence encoding amino acids 7-89 (an additional nucleotide (T) to the 5' end keep it in frame) of mouse Rhotekin into the EcoRI-BamH1 sites of pYPet-C1. The insert was from Dr. Natalie Lamarche-Vane (McGill University).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ypet-RBD was a gift from Kenneth Yamada (Addgene plasmid # 105291 ; http://n2t.net/addgene:105291 ; RRID:Addgene_105291) -
For your References section:
Nonpolarized signaling reveals two distinct modes of 3D cell migration. Petrie RJ, Gavara N, Chadwick RS, Yamada KM. J Cell Biol. 2012 Apr 30;197(3):439-55. doi: 10.1083/jcb.201201124. 10.1083/jcb.201201124 PubMed 22547408