Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pECFP-Cdc42-Y40C
(Plasmid #105295)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105295 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cdc42
  • Alt name
    CDC42
  • Species
    H. sapiens (human)
  • Mutation
    Y40C
  • Entrez Gene
    CDC42 (a.k.a. CDC42Hs, G25K, TKS)
  • Tag / Fusion Protein
    • CFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Human Cdc42 sequence cloned with a nucleotide (C) added to the 5' end to keep it in frame. Amino acid Y at position 40 of the protein sequence is mutated to C. The insert was from Dr. Natalie Lamarche-Vane (McGill University).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pECFP-Cdc42-Y40C was a gift from Kenneth Yamada (Addgene plasmid # 105295 ; http://n2t.net/addgene:105295 ; RRID:Addgene_105295)
  • For your References section:

    Nonpolarized signaling reveals two distinct modes of 3D cell migration. Petrie RJ, Gavara N, Chadwick RS, Yamada KM. J Cell Biol. 2012 Apr 30;197(3):439-55. doi: 10.1083/jcb.201201124. 10.1083/jcb.201201124 PubMed 22547408