MSCV-Neo-GFP/V5-Foxa1-(P2A)-Flag-Gata5
(Plasmid
#105509)
-
PurposeMSCV-driven retroviral Foxa1 and Gata5 expression (P2A-linked, V5 and Flag-tagged each)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMSCV-Neo-IRES-GFP
- Backbone size w/o insert (bp) 7795
-
Vector typeRetroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFoxa1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1401
-
GenBank ID
-
Entrez GeneFoxa1 (a.k.a. Hnf-3a, Hnf3a, Tcf-3a, Tcf3a)
-
Tag
/ Fusion Protein
- V5 (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGata5
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1212
-
Entrez GeneGata5
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-Neo-GFP/V5-Foxa1-(P2A)-Flag-Gata5 was a gift from Christopher Vakoc (Addgene plasmid # 105509 ; http://n2t.net/addgene:105509 ; RRID:Addgene_105509) -
For your References section:
Enhancer Reprogramming Promotes Pancreatic Cancer Metastasis. Roe JS, Hwang CI, Somerville TDD, Milazzo JP, Lee EJ, Da Silva B, Maiorino L, Tiriac H, Young CM, Miyabayashi K, Filippini D, Creighton B, Burkhart RA, Buscaglia JM, Kim EJ, Grem JL, Lazenby AJ, Grunkemeyer JA, Hollingsworth MA, Grandgenett PM, Egeblad M, Park Y, Tuveson DA, Vakoc CR. Cell. 2017 Aug 24;170(5):875-888.e20. doi: 10.1016/j.cell.2017.07.007. Epub 2017 Jul 27. 10.1016/j.cell.2017.07.007 PubMed 28757253