Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MSCV-Neo-GFP/V5-Foxa1-(P2A)-Flag-Gata5
(Plasmid #105509)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105509 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCV-Neo-IRES-GFP
  • Backbone size w/o insert (bp) 7795
  • Vector type
    Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Foxa1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1401
  • GenBank ID
  • Entrez Gene
    Foxa1 (a.k.a. Hnf-3a, Hnf3a, Tcf-3a, Tcf3a)
  • Tag / Fusion Protein
    • V5 (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Gata5
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1212
  • Entrez Gene
    Gata5
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-Neo-GFP/V5-Foxa1-(P2A)-Flag-Gata5 was a gift from Christopher Vakoc (Addgene plasmid # 105509 ; http://n2t.net/addgene:105509 ; RRID:Addgene_105509)
  • For your References section:

    Enhancer Reprogramming Promotes Pancreatic Cancer Metastasis. Roe JS, Hwang CI, Somerville TDD, Milazzo JP, Lee EJ, Da Silva B, Maiorino L, Tiriac H, Young CM, Miyabayashi K, Filippini D, Creighton B, Burkhart RA, Buscaglia JM, Kim EJ, Grem JL, Lazenby AJ, Grunkemeyer JA, Hollingsworth MA, Grandgenett PM, Egeblad M, Park Y, Tuveson DA, Vakoc CR. Cell. 2017 Aug 24;170(5):875-888.e20. doi: 10.1016/j.cell.2017.07.007. Epub 2017 Jul 27. 10.1016/j.cell.2017.07.007 PubMed 28757253