Skip to main content

pBad-CA TAG20
(Plasmid #105666)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105666 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBad
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4100
  • Total vector size (bp) 4900
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    human carbonic anhydrase II thermostable variant
  • Alt name
    HCAII
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    801
  • Mutation
    TAG stop codon at site 20
  • Entrez Gene
    CA2 (a.k.a. CA-II, CAC, CAII, Car2, HEL-76, HEL-S-282)
  • Promoter pBad/arabinose
  • Tag / Fusion Protein
    • 6x his tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://openlibrary-repo.ecampusontario.ca/jspui/handle/123456789/838 for Chemical Biology & Biochemistry Laboratory Using Genetic Code Expansion Manual.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBad-CA TAG20 was a gift from Ryan Mehl (Addgene plasmid # 105666 ; http://n2t.net/addgene:105666 ; RRID:Addgene_105666)
  • For your References section:

    Chemical Biology & Biochemistry Laboratory : Using Genetic Code Expansion Manual. Mehl R, van Zee K, Kean K. 2020