-
PurposeDonor construct for introduction of NGN2 into AAVS1 safe harbor site and iPSC differentiation to cortical neuron
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105840 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUCM
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 10618
-
Modifications to backboneAAVS1 homology arms
-
Vector typeCRISPR, TALEN
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNeurogenin 2
-
Alt nameNGN2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)819
-
GenBank IDNM_024019
-
Entrez GeneNEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
- Promoter TRE3G
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTCGTTTAGTGAACCGTCAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
Alt namemcherry
-
SpeciesSynthetic
-
Insert Size (bp)702
- Promoter EF-1alpha
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer gcgcctacgctagcgctac
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namertTA3G
-
Alt namertTA3G
-
Insert Size (bp)747
- Promoter CAG
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer ctggttattgtgctgtctc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byTre3G and rTTA are from Clontech Plasmid (TetOne Lenti Vector)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid may runs as a dimer (>21kb). Concatenation/Dimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCM-AAVS1-TO-hNGN2 was a gift from Michael Ward (Addgene plasmid # 105840 ; http://n2t.net/addgene:105840 ; RRID:Addgene_105840) -
For your References section:
Transcription Factor-Mediated Differentiation of Human iPSCs into Neurons. Fernandopulle MS, Prestil R, Grunseich C, Wang C, Gan L, Ward ME. Curr Protoc Cell Biol. 2018 Jun;79(1):e51. doi: 10.1002/cpcb.51. Epub 2018 May 18. 10.1002/cpcb.51 PubMed 29924488