Skip to main content

pFUSEss-CHIg-mG3_CH2-1
(Plasmid #105857)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105857 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUSEss-CHIg-mG3 (modified)
  • Backbone manufacturer
    Invivogen
  • Backbone size w/o insert (bp) 4474
  • Total vector size (bp) 4829
  • Modifications to backbone
    hybrid heavy chain of mouse IgG3 with CH2 derived from mouse IgG1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IgG1, IgG3
  • Alt name
    Ighg3
  • Alt name
    Ighg1
  • Species
    M. musculus (mouse)
  • Mutation
    hybrid heavy chain of mouse IgG3 with CH2 derived from mouse IgG1
  • Entrez Gene
    Ighg1 (a.k.a. IgG1, Igh-4, VH7183)
  • Entrez Gene
    Ighg3 (a.k.a. IgG3)
  • Promoter hEF1-HTLV prom

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site AfeI (not destroyed)
  • 5′ sequencing primer ATGTACAGGATGCAACTCCTG
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUSEss-CHIg-mG3_CH2-1 was a gift from Joanna Bereta (Addgene plasmid # 105857 ; http://n2t.net/addgene:105857 ; RRID:Addgene_105857)
  • For your References section:

    CH2 Domain of Mouse IgG3 Governs Antibody Oligomerization, Increases Functional Affinity to Multivalent Antigens and Enhances Hemagglutination. Klaus T, Bereta J. Front Immunol. 2018 May 23;9:1096. doi: 10.3389/fimmu.2018.01096. eCollection 2018. 10.3389/fimmu.2018.01096 PubMed 29875771