-
PurposehROSA26 targeting CRISPR plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehROSA26 gRNA
-
gRNA/shRNA sequenceTTGCAGCTCGCGCCGGTTTT
-
SpeciesH. sapiens (human)
- Promoter U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer aggctgttagagagataattgg
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Based on pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hROSA26 CRISPR-pX330 was a gift from Masato Kanemaki (Addgene plasmid # 105927 ; http://n2t.net/addgene:105927 ; RRID:Addgene_105927) -
For your References section:
Dynein-Dynactin-NuMA clusters generate cortical spindle-pulling forces as a multi-arm ensemble. Okumura M, Natsume T, Kanemaki MT, Kiyomitsu T. Elife. 2018 May 31;7. pii: 36559. doi: 10.7554/eLife.36559. 10.7554/eLife.36559 PubMed 29848445