Skip to main content

pZA-GFP-R5
(Plasmid #106256)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106256 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZA
  • Backbone manufacturer
    expressys
  • Backbone size w/o insert (bp) 2091
  • Total vector size (bp) 2880
  • Modifications to backbone
    Promoter replaced by constitutively active promoter proD
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Green fluorescent protein
  • Alt name
    GFP
  • Insert Size (bp)
    789
  • Tag / Fusion Protein
    • Added silaffin R5 peptide to C terminus of GFP after GGGGS linker (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTTTCGCCAGATATCGACGTCT
  • 3′ sequencing primer CGTTCGTAAGCCATTTCCGCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZA-GFP-R5 was a gift from Urartu Seker (Addgene plasmid # 106256 ; http://n2t.net/addgene:106256 ; RRID:Addgene_106256)
  • For your References section:

    Autonomous Synthesis of Fluorescent Silica Biodots Using Engineered Fusion Proteins. Olmez TT, Yuca E, Eyupoglu E, Catalak HB, Sahin O, Seker UOS. ACS Omega. 2018 Jan 31;3(1):585-594. doi: 10.1021/acsomega.7b01769. Epub 2018 Jan 18. 10.1021/acsomega.7b01769 PubMed 30023783